Clone Read LE_HBa0079G13_SP6_19896

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0079G13_SP6_19896
Primer
SP6
ID from Seq. Facility
LE_HBa_079_G13-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
691 trimmed for vector and quality, 914 raw
Genbank Accession
Sequence
>LE_HBa0079G13_SP6_19896 (raw untrimmed)
TGGGTTTTGGTTGTATAACCTGCTTTCACAACCAATCGTGCCTTGAACCTTTCTATGCTCCCATATGCTTTGTGTTTTACTTTGTATACCCACCCACATC
CAACTGCTTATTTGTTTGGTGGTAAAGTAACAAGATCCCAAGTGTCATTATCATACAGTGCTTCAAACTCTTGTATCATGGCCTTTTGCCATGCAAGATT
CAGTGATGCTTCCTCATATGATGATGGCTCACTATCATGACAAATGTTCTCAACAAGTGACTGACTAGTAGATGCAATGACTTCAGGAGATATATGGTGG
TGTTTGGTAAACAATGCAGTAAGGGATAGATTATTGTTGATCTCTGTGTTTTGTGTGTTGGAATTGACTGATTTTAGTTTTGGGATATTGATAACATAAT
CTTTCAAATGTGATGGTATTTTGTTTTCTCTATGAGATCTTCTCTGTACTATTGTGGGAGGATTGTGTTGGGATGATGTTGAAGAGGTAATGGGAGCACT
GGAAGATATACTGGGATTTTGACTAATGTGAGAAGATATATGAGGAGGAGTTGTATCAGTCACATTGTCACAATCATTTACACAGCCTTTATATGAATCT
AAATCAGCATAATCAGAGGATGAAAAAGACTTTAAAACAGAAGGAAAAGAAGGATTTTCAGTTGACAAAGCAAAAGGAAAAACATGTTCATGGAAAATCA
CATCTCTGGAGATATGTATCTTCTTTGTAGCCCGACTCATCACCTTATAACCTTTGGTTCCAAAATATATCCCTAAGAAATGTGTGGTGTGGTTTTTGGT
TAAACCTGTCCTCAACTACCTTGGAATAGTGGGGTAACAAGACAACCAAGCAATCTAGCTGACTTTGTTTGGTTTCTTATTGTAAAACCTTCATAGGACC
TTATTTTTCCACAC
>LE_HBa0079G13_SP6_19896 (trimmed for quality and cloning vector)
CAACCAATCGTGCCTTGAACCTTTCTATGCTCCCATATGCTTTGTGTTTTACTTTGTATACCCACCCACATCCAACTGCTTATTTGTTTGGTGGTAAAGT
AACAAGATCCCAAGTGTCATTATCATACAGTGCTTCAAACTCTTGTATCATGGCCTTTTGCCATGCAAGATTCAGTGATGCTTCCTCATATGATGATGGC
TCACTATCATGACAAATGTTCTCAACAAGTGACTGACTAGTAGATGCAATGACTTCAGGAGATATATGGTGGTGTTTGGTAAACAATGCAGTAAGGGATA
GATTATTGTTGATCTCTGTGTTTTGTGTGTTGGAATTGACTGATTTTAGTTTTGGGATATTGATAACATAATCTTTCAAATGTGATGGTATTTTGTTTTC
TCTATGAGATCTTCTCTGTACTATTGTGGGAGGATTGTGTTGGGATGATGTTGAAGAGGTAATGGGAGCACTGGAAGATATACTGGGATTTTGACTAATG
TGAGAAGATATATGAGGAGGAGTTGTATCAGTCACATTGTCACAATCATTTACACAGCCTTTATATGAATCTAAATCAGCATAATCAGAGGATGAAAAAG
ACTTTAAAACAGAAGGAAAAGAAGGATTTTCAGTTGACAAAGCAAAAGGAAAAACATGTTCATGGAAAATCACATCTCTGGAGATATGTAT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.939161
Expected error %
0.23412
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At4g23160.1 Score 86 E Value 1e-17 Identity 11.80% Align. Length 440bp (63.68%) Frame 3
68417.m03342 protein kinase family protein contains Pfam domain PF00069: Protein kinase domain
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT40535.1| Score 99 E Value 8e-20 Identity 19.00% Align. Length 236bp (34.15%) Frame 3
hypothetical protein PGEC407.1 [Solanum demissum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAU89728.1| Score 99 E Value 1e-19 Identity 10.10% Align. Length 683bp (98.84%) Frame 3
putative retroelement pol polyprotein-like [Solanum tuberosum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0079G13
Clone
Clone name
hba-79g13
LE_HBa0079G13
P079G13
Clone type
BAC
Contamination
none
Estimated length
52,476
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found