Clone Read LE_HBa0079G13_T7_19897

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0079G13_T7_19897
Primer
T7
ID from Seq. Facility
LE_HBa_079_G13-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
868 trimmed for vector and quality, 970 raw
Genbank Accession
Sequence
>LE_HBa0079G13_T7_19897 (raw untrimmed)
AGACTCCGGTCCCGGGGGAATCTCTAGAGTCGACCTGCAGGCATGCAAGCTTAGCAATTGTCACACAAGTTGACCCGATAAGGGTTTGACATTCAAATGT
AATTAAACTAAACTTCAGAACTTGTAGTCTTATACATTTATATGACTACAAGATCGATCGTGTTGAGATATACAAGTATGTCATTTTTTTCTTGCTCCTC
CACAGCCGATTTTGAACCTTCAACTCATTGTCCTCTTTAGCGATGATCATACAGTCCATGCTTGACTGATTCTACCATAGCTTGATGGTTAATGATTTTG
CTTGTGTATCTGCAATTTATCAAGTTAGCTCTCAATAAGATGCAGATAAATTTTCAAACTTGCAATATTTTGTTGGATAAAAAAACTAGCCGGTCTTGCA
ATTGGTTTTATTTGAAGATACAACCAAATATTATCATCATGTTTGTATCTAAATTTATTTAATTATATTAAAGAAAAATCATATGAAGCAATATGTAGAA
GAAGAAGAAAAAAAGACAAGAATACATGCTTTATAAAAAGAAAAAGAAACAATGTAGTACTTGCCAAGACAGAGAAAAAAAATTATATCGTTCCTCCCCT
AATATTTTGCTATCATTCATAATTAAGCAAATTATACCTACAGAGTCCTATTTGAGGCGTAATGTTTGCTATTTTCGAACTTTTCCTAAAATATGTCAAT
TATGTTTATAGCAATTCAATAAACATGAGAAGCAGACCGAAATAACTTGTATGTTTACACCAAGTCAATGTAATACGTGATTTAATGAGGTAAAACACAT
GTAAATTTATTATGGGTTAAGTACAATGAACTATTAATTTAACACATAGCATGTATGTATTGACTTGATGTTACAATCAGTGGGGGTAAATTTACCCCCT
AATTACTTAATATGATTAAGCGAACAACTAAATAGCAGAACCGTAAGATAAATTCAAATTTTACTTTGGA
>LE_HBa0079G13_T7_19897 (trimmed for quality and cloning vector)
AGCTTAGCAATTGTCACACAAGTTGACCCGATAAGGGTTTGACATTCAAATGTAATTAAACTAAACTTCAGAACTTGTAGTCTTATACATTTATATGACT
ACAAGATCGATCGTGTTGAGATATACAAGTATGTCATTTTTTTCTTGCTCCTCCACAGCCGATTTTGAACCTTCAACTCATTGTCCTCTTTAGCGATGAT
CATACAGTCCATGCTTGACTGATTCTACCATAGCTTGATGGTTAATGATTTTGCTTGTGTATCTGCAATTTATCAAGTTAGCTCTCAATAAGATGCAGAT
AAATTTTCAAACTTGCAATATTTTGTTGGATAAAAAAACTAGCCGGTCTTGCAATTGGTTTTATTTGAAGATACAACCAAATATTATCATCATGTTTGTA
TCTAAATTTATTTAATTATATTAAAGAAAAATCATATGAAGCAATATGTAGAAGAAGAAGAAAAAAAGACAAGAATACATGCTTTATAAAAAGAAAAAGA
AACAATGTAGTACTTGCCAAGACAGAGAAAAAAAATTATATCGTTCCTCCCCTAATATTTTGCTATCATTCATAATTAAGCAAATTATACCTACAGAGTC
CTATTTGAGGCGTAATGTTTGCTATTTTCGAACTTTTCCTAAAATATGTCAATTATGTTTATAGCAATTCAATAAACATGAGAAGCAGACCGAAATAACT
TGTATGTTTACACCAAGTCAATGTAATACGTGATTTAATGAGGTAAAACACATGTAAATTTATTATGGGTTAAGTACAATGAACTATTAATTTAACACAT
AGCATGTATGTATTGACTTGATGTTACAATCAGTGGGGGTAAATTTACCCCCTAATTACTTAATATGA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.937564
Expected error %
0.664515
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0079G13
Clone
Clone name
hba-79g13
LE_HBa0079G13
P079G13
Clone type
BAC
Contamination
none
Estimated length
52,476
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found