Clone Read LE_HBa0142O01_T7_200006

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0142O01_T7_200006
Primer
T7
ID from Seq. Facility
LE_HBa_142_O01-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
7 trimmed for vector and quality, 791 raw
Sequence
>LE_HBa0142O01_T7_200006 (raw untrimmed)
TACATCCACACAAAAAAAAATAAAAATGAAATATGGACTTGACGAAAAAATTGGTACATACCCCTCGGGTCAAATAAATCAAAAGCAGATCAAAATACTA
TGGGGAACGGGGAGGGGCTCGACTTCGCGATAATTTTAAAAATCCATCGTATACCCCCCCTCTTATAACCATTTTAAGGTAGGTGATGAGATGGAGATTA
TAGTTGATGAAAACTTAGTGCTTAAAGAAAAAGAACGGCTGCCAGTATTATATAAAGACATACCTAGCAATAA
ATTAAAAGTAGTTGATGGATTAATTAT
TCCAGCAACAAGGCTACGTGTAATGCTTGAATACATGTGGGAAGACGTCAAAGAAAAAGGTGACTACGATTTATTTACTCAATCTGATAAGGCGCCACCA
TATGAAAGGGAAATACCAGTAGCCAAACTACTTAATGCTAGAGATGCGGCATATCCAAACATAACCCCACTACTATTCGATCTCCTTGCCGACCAGAAAG
ACTACACAAAATCGCCATCTGATGAATTCTAAGATTAGCATTAACTACTTGAGAATAATTATTTTGTGTAATCTAGGCAGTGCTTCTTCATAATAAAAAC
TGTCTCTTTATTATTACACTACCATATATCCACATAGACGATACTTTTGAAATCATTCTACGTGTATCCACTTTTCACATTGTATTACTGCCTATTCGCT
ATCTCTGTCTGCTCGCCTCCCTCTCGGCCCTTCTTTCAGCTTTCCCTCTTCTTCTCTATCATCCCACGTTCTCACGTCTCTCATCTAGCCC
>LE_HBa0142O01_T7_200006 (trimmed for quality and cloning vector)
ATTAAAA

This is probably not a useful sequence.

Problems:
  • Low complexity
  • Short cloning insert
Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
not recorded
Expected error %
0.758676
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0142O01
Clone
Clone name
hba-142o1
LE_HBa0142O01
P142O01
Clone type
BAC
Contamination
none
Estimated length
99,219
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found