Clone Read LE_HBa0155K06_SP6_200927

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0155K06_SP6_200927
Primer
SP6
ID from Seq. Facility
LE_HBa_155_K06-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
433 trimmed for vector and quality, 914 raw
Sequence
>LE_HBa0155K06_SP6_200927 (raw untrimmed)
GGGGCAGGATTTGAAAAATGAAATCGAGATGGAGTTTGAGCGCTTACCTTTTGAGATGGAGACTTCAAAATGTTTCCCCTTTGATCTTCGAGGTGGAGAC
TTGCTTCATCCCAGGCATGCTTCGCCAGCCCCAACTTACTGAGGCTCTAAATGGTGCACTGTTGACGCGCCGCCCCATCCTTCCTGGCACTATGGGGGCA
CGTCGTGCCACCTATTCCTTCAGGCAAAAACTGACAAACTTTTGGTCTCATTTTCTGATCTTAAATCGATTTAACCCAATTCTTTTTCTCAAATTCACAT
TAGATTCATGTACCCAAATCATATACACAAGGATCTTACTCTGAGAACTCAAGGAAACGACACTTTAACATCAAGAAACTCCTTAATCTCAACGCATATT
CAAAAATGAAATCAATTCAAGAACAACTATCAACAAAATCAAATTCTCAATTTTTTAGGATGAAAATACGCTTTTTTTTACCTGTCTGACGCGTGATTGA
GCTAACCCAATGATATGAGAGATCACTCACCCTCGCATGGATCACCCCCTTGATTAAATTCACGATCAAACTTTAATGATCCTGACGAATCTTGCATTTT
CTCCTCTTTTCTCCTCTTACTTTATCCATACTCTCAAATTCCTAACTCTTTTTTTCAAATAATAAATTTTACTTTATATATAATTTCTATACAATTAATT
ATTCAAACATCTACATAACAGTTATTTTGTTTATTACATTATCCTTGCTATCCCCTTTAATATTTCCGATTTCCTCATTCCTTTATTTTTTTATCTATTA
TTTTACATTATGTAACATCTTTTTATTTCTTTACATTATTTCCTTTATATCTCTTTAATTTTTTTTTTTTTTCTTTTATAATATCTTACTTTTCTTCAAC
TTTTTTTTTTTTTT
>LE_HBa0155K06_SP6_200927 (trimmed for quality and cloning vector)
TTGAGCGCTTACCTTTTGAGATGGAGACTTCAAAATGTTTCCCCTTTGATCTTCGAGGTGGAGACTTGCTTCATCCCAGGCATGCTTCGCCAGCCCCAAC
TTACTGAGGCTCTAAATGGTGCACTGTTGACGCGCCGCCCCATCCTTCCTGGCACTATGGGGGCACGTCGTGCCACCTATTCCTTCAGGCAAAAACTGAC
AAACTTTTGGTCTCATTTTCTGATCTTAAATCGATTTAACCCAATTCTTTTTCTCAAATTCACATTAGATTCATGTACCCAAATCATATACACAAGGATC
TTACTCTGAGAACTCAAGGAAACGACACTTTAACATCAAGAAACTCCTTAATCTCAACGCATATTCAAAAATGAAATCAATTCAAGAACAACTATCAACA
AAATCAAATTCTCAATTTTTTAGGATGAAAATA

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.960016
Expected error %
0.44585
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0155K06
Clone
Clone name
hba-155k6
LE_HBa0155K06
C06HBa0155K06
P155K06
Clone type
BAC
Contamination
none
Estimated length
140,869
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found