Clone Read LE_HBa0155K06_T7_200928

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0155K06_T7_200928
Primer
T7
ID from Seq. Facility
LE_HBa_155_K06-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
499 trimmed for vector and quality, 936 raw
Sequence
>LE_HBa0155K06_T7_200928 (raw untrimmed)
CCCAACCCGGGACCGGGGGTATCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGTCACATACCTAAACCACTCCCTATTAAGGAGGGGAAATCTCGGATT
ACAACCGTCATACTTGCCCTATTGGAGGTCTTGTACAAGCCCTTTCATATCAATCATCACATATACATAATGAAAAGTAGTGCAGAATTAAATCTTTTCA
CAGAACAGTTCATAGTCTTTAAAAATACTTTCAAATAAAGTCATAGGAAATACAAAGTCTCAATCTCATCAAACTTAAGATATGAGAATACCTTTGGGAC
ATGGCCCATACACAATACTAATATAGATATACTTAGTCTATTACAATACTTCAATAAGAAACATAAAAGACGTCAATGCCCTCGAATCAAATGAGGACAT
ACTTCGACTACACTTGAATGATGCCATGATCAAAGTCTTCTTTTCCAAATGCTCTTCCTCTACCAGCAACTATAGAAATAGATAAAAGTATGGATTAGTA
CCACCATATATACTAAGTATGGAATAATGCATTAAAAATCATGAAAATGGACATTAATAGAAATATGCATCTTTTCATTTAAAATCATTTTTAACATCAA
AGAAAAACTTTTAACCACTTTATTATCTTCTTACATCGAATTTTTACATTTTTTTCCATTTCTATCTCTATTTTCTTTTAATTTTCTACTCATTTATATA
TTAAATATCTTACTCGCTTCCATTGGACGGGTTCAACTCGCAGATCGCATGCGGTCACTGGAGTGCGAGAAATCCGTCCATGTTGCGGAGCAGCCTTCGA
GATCGTAGCTAGGGCCTTACTCTGGCTCTTCTAATGTTACTTCCTTTCTAATTTCTTTTCTCCCTTTTATTCCATCCTTTCTTTTCCATACATCACTGGC
ATAATTCTCTTTCTATAAGTTTTACACTTCCTTGTC
>LE_HBa0155K06_T7_200928 (trimmed for quality and cloning vector)
AGCTTGTCACATACCTAAACCACTCCCTATTAAGGAGGGGAAATCTCGGATTACAACCGTCATACTTGCCCTATTGGAGGTCTTGTACAAGCCCTTTCAT
ATCAATCATCACATATACATAATGAAAAGTAGTGCAGAATTAAATCTTTTCACAGAACAGTTCATAGTCTTTAAAAATACTTTCAAATAAAGTCATAGGA
AATACAAAGTCTCAATCTCATCAAACTTAAGATATGAGAATACCTTTGGGACATGGCCCATACACAATACTAATATAGATATACTTAGTCTATTACAATA
CTTCAATAAGAAACATAAAAGACGTCAATGCCCTCGAATCAAATGAGGACATACTTCGACTACACTTGAATGATGCCATGATCAAAGTCTTCTTTTCCAA
ATGCTCTTCCTCTACCAGCAACTATAGAAATAGATAAAAGTATGGATTAGTACCACCATATATACTAAGTATGGAATAATGCATTAAAAATCATGAAAA

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.944791
Expected error %
0.685888
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0155K06
Clone
Clone name
hba-155k6
LE_HBa0155K06
C06HBa0155K06
P155K06
Clone type
BAC
Contamination
none
Estimated length
140,869
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found