Clone Read LE_HBa0155M10_SP6_201031

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0155M10_SP6_201031
Primer
SP6
ID from Seq. Facility
LE_HBa_155_M10-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
311 trimmed for vector and quality, 729 raw
Sequence
>LE_HBa0155M10_SP6_201031 (raw untrimmed)
CTTTAGGCCGCGTTAATTTATGGCTGTGGGCAACCATAATGCAACTCTTGTTACCCAGGTTTTTTCCACTTTCTGGTGTAACGAAATCGTGTCATACCTC
GAGATATCTTGTTATCAACATTTTGGTGCTGAAATTGAAGCCTTCAACTGATTCTCCTTTCTTACGAGATGCATGAAGTTGCTTTCTAACTTGAGTCGCT
AGAGACTGCAGAGGACATAAATAAACAAGGTACTCAGTATTATATTAGTATTATAGAATGTTCAATTACTCAATTTAAGGCATTTTCTTAGAAGTACCTT
TCCTAGTCTCCACACCCCACTGATCAAAAGAATTGATACCCCATACGAAGCCTTGGACTGCAACTCTGTGCTCGTAGATGGCCAGTAACTGAAAGAAAGG
AAAGATGATATCTTTTTTTATGACATTACGGATCACAAGAAGAGGAATGGGTACTTTAAAAGGAGGGATATTGTCCCTTCTTTGGCAGCATGCCACAAAA
AAGGAAGAAAAAGGTTAAGATTGAATAATATTTTTTTTGAAAAAACACCCCATATTTAAACTCTGAATTTTCTTTTATTTTAAGGTTTGAACAAAAAAAA
TGTCCTGAACAAATAAAAATCACCCATTCTCCCCCCCTTCCTTTCAGGGTTATATTTTCCATTTTTTCTATCTTTAGTTTTTTATGTTTTATTTAATTCT
TCTTATTTTTTATAACTTTTTTTTTTTTT
>LE_HBa0155M10_SP6_201031 (trimmed for quality and cloning vector)
TTTTTCCACTTTCTGGTGTAACGAAATCGTGTCATACCTCGAGATATCTTGTTATCAACATTTTGGTGCTGAAATTGAAGCCTTCAACTGATTCTCCTTT
CTTACGAGATGCATGAAGTTGCTTTCTAACTTGAGTCGCTAGAGACTGCAGAGGACATAAATAAACAAGGTACTCAGTATTATATTAGTATTATAGAATG
TTCAATTACTCAATTTAAGGCATTTTCTTAGAAGTACCTTTCCTAGTCTCCACACCCCACTGATCAAAAGAATTGATACCCCATACGAAGCCTTGGACTG
CAACTCTGTGC

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.957523
Expected error %
0.5042
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At5g42740.1 Score 82 E Value 7e-17 Identity 16.80% Align. Length 272bp (87.46%) Frame 3
68418.m05205 glucose-6-phosphate isomerase, cytosolic (PGIC) identical to SP|P34795 Glucose-6-phosphate isomerase, cytosolic (EC 5.3.1.9) (GPI) (Phosphoglucose isomerase) (PGI) (Phosphohexose isomerase) (PHI) {Arabidopsis thaliana}; contains Pfam profile PF00342: glucose-6-phosphate isomerase
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
emb|CAC85684.1| Score 98 E Value 8e-20 Identity 18.80% Align. Length 302bp (97.11%) Frame 3
cytosolic phosphoglucose isomerase [Clarkia similis]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
emb|CAC85683.1| Score 98 E Value 8e-20 Identity 18.80% Align. Length 302bp (97.11%) Frame 3
cytosolic phosphoglucose isomerase [Clarkia similis]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0155M10
Clone
Clone name
hba-155m10
LE_HBa0155M10
P155M10
Clone type
BAC
Contamination
none
Estimated length
110,766
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found