Clone Read LE_HBa0155M10_T7_201032

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0155M10_T7_201032
Primer
T7
ID from Seq. Facility
LE_HBa_155_M10-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
512 trimmed for vector and quality, 909 raw
Sequence
>LE_HBa0155M10_T7_201032 (raw untrimmed)
CTAACCCGGTCCCGCGGGGATCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGGTGGGCTAAAAGAAAAGGCAAGACAATGAAGCAACCAAATATGCTTT
GCCATTTCACAAAATGTGTAAAAGAAATGTGTTTTTTCGGATACTCATTAGAATTCAGTAAATTCCTCTGATCCAAATTCCCAAAAAGGGATTTTTCCAA
TTTGGGATTGATGAGTTTCAAGTACTTTGTAACACAAAATCTCGCGAATTTTGATTTTGGCTTCCTGGTAAGTAATCTGTTGGTATAACAGATTTCAATT
CTGTTGAAAAATATATCTGATCGTTTTGACTGATGAACAGAGGAGTATGGATCGTTGTGTTAGGATCGAATTCACGCACACACTTGATAAATGAAGAACA
CAAGAACTTTCAAGAGAAACAGATGAGAGATCTAGAGAGAGAACTTTCAAGAGAAAGAGATGAGAGATCTAGAGAGAAACCAATATTTTGTGGTAACAAT
CCGTGAGTAAATTTCCACGGCGGTGGGGTATATATATTAATAAATCGGAGGATTTTTTTGATACATAAAAAAATGAAGAAGGAATAAGATAGCCGAAATT
TCTTGGCCGGGGCCTGCCCCCAACCGTTACTTAGGGTGTATATGTTTAGACGCTGTGGGACGTCCCTATGAGTTGTATTTGATATGTATTGTCTCATCTT
CTCTGATGGCGATACTTCTGGCGATGTATCCCGCGCCTCCTTTGGGGATCTCAGGCTTCGCCTCTTCCTCACACCTGCTTGATATTGTTGACCGGGCCCA
CAAATATACGATTCCAAGCACTCCCACTCTTTAACTCCACCTCCATCCCTCGAGTTCACTCCCGACGTATCATATCGTAGATACTTACTATTATANAACT
ACTTTTTAG
>LE_HBa0155M10_T7_201032 (trimmed for quality and cloning vector)
AGCTTGGTGGGCTAAAAGAAAAGGCAAGACAATGAAGCAACCAAATATGCTTTGCCATTTCACAAAATGTGTAAAAGAAATGTGTTTTTTCGGATACTCA
TTAGAATTCAGTAAATTCCTCTGATCCAAATTCCCAAAAAGGGATTTTTCCAATTTGGGATTGATGAGTTTCAAGTACTTTGTAACACAAAATCTCGCGA
ATTTTGATTTTGGCTTCCTGGTAAGTAATCTGTTGGTATAACAGATTTCAATTCTGTTGAAAAATATATCTGATCGTTTTGACTGATGAACAGAGGAGTA
TGGATCGTTGTGTTAGGATCGAATTCACGCACACACTTGATAAATGAAGAACACAAGAACTTTCAAGAGAAACAGATGAGAGATCTAGAGAGAGAACTTT
CAAGAGAAAGAGATGAGAGATCTAGAGAGAAACCAATATTTTGTGGTAACAATCCGTGAGTAAATTTCCACGGCGGTGGGGTATATATATTAATAAATCG
GAGGATTTTTTT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.943201
Expected error %
0.395616
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At3g14870.1 Score 62 E Value 9e-17 Identity 44.40% Align. Length 295bp (57.62%) Frame 3
68416.m01880 expressed protein contains Pfam profile PF04859: Plant protein of unknown function (DUF641
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At1g29300.1 Score 56 E Value 7e-17 Identity 57.80% Align. Length 214bp (41.80%) Frame 3
68414.m03582 expressed protein contains Pfam profile PF04859: Plant protein of unknown function (DUF641
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
dbj|BAA97050.1| Score 62 E Value 4e-15 Identity 44.40% Align. Length 295bp (57.62%) Frame 3
unnamed protein product [Arabidopsis thaliana]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAO64011.1| Score 62 E Value 4e-15 Identity 44.40% Align. Length 295bp (57.62%) Frame 3
unknown protein [Arabidopsis thaliana] gb|AAO42328.1| unknown protein [Arabidopsis thaliana]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0155M10
Clone
Clone name
hba-155m10
LE_HBa0155M10
P155M10
Clone type
BAC
Contamination
none
Estimated length
110,766
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found