Clone Read LE_HBa0155N10_SP6_201079

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0155N10_SP6_201079
Primer
SP6
ID from Seq. Facility
LE_HBa_155_N10-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
110 trimmed for vector and quality, 752 raw
Sequence
>LE_HBa0155N10_SP6_201079 (raw untrimmed)
TTTTTAATCCAGAAGGTGTTTACTTAAGAAGTCTCTGTTAGATTTNGTTTNGTTTTTACGTCGTTTNGNGGGTTTGTGAAATGGTAAATTTTTTTATGTT
TTTACCTAATGTTTTTATAGTTCTTGTTTTCTCGAAGAAAGAATCCAAAATACACATGTAGAAAGATCTTCCTTTTTGCTGTTTTAGTTGGGTTGTTCTT
GTGGTTTTNTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTTTTTTNTTTTTTNTNTNNNTNNNTTNNNTTTTTNNNTNNNTNNTTTTT
TTNNNTTTTNTTNNNNTTTTTNTTNTTTTTTTTTNTTTTTNTTTTTTTTNTTTTTTTTTTTNNNTTNTTTTTTNNTTTTTTTTNNTTTTTTTTTTTTTNT
TTTTTTTTTTTNTNTTTTTTNNTTTTNTTTTTTTTTTTTTTNTTNTTNTNTNTNTNNTNNTTTTTTTTTTTTTNNTNNTTTTTTNTTTTTTTTTTTTTTT
TTTTTTTTTTTTTTTTTTTTTTNTTTNTTTTTTTTTTTNNNTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTNNTT
TTTTTTTTTNNNTTTNTTTTTTTTTTTTTTTTNTTTTTTTTNTNTTTTTTTTTTTTTTTTNTTNNTTTTTTTTTTTTTTTTTNNTTTTNTTNTTTTTTTT
TTTTTTTTTTTTTTTTTTTTNNTTTNTTTTNTTTTTTTTTTTTTTTTTTTTT
>LE_HBa0155N10_SP6_201079 (trimmed for quality and cloning vector)
ATGTTTTTACCTAATGTTTTTATAGTTCTTGTTTTCTCGAAGAAAGAATCCAAAATACACATGTAGAAAGATCTTCCTTTTTGCTGTTTTAGTTGGGTTG
TTCTTGTGGT

This is probably not a useful sequence.

Problems:
  • Short cloning insert
Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.864782
Expected error %
0.568325
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0155N10
Clone
Clone name
hba-155n10
LE_HBa0155N10
P155N10
Clone type
BAC
Contamination
none
Estimated length
104,031
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found