Clone Read LE_HBa0155O16_T7_201140

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0155O16_T7_201140
Primer
T7
ID from Seq. Facility
LE_HBa_155_O16-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
660 trimmed for vector and quality, 906 raw
Sequence
>LE_HBa0155O16_T7_201140 (raw untrimmed)
CGTAGCATGGTACCGAGGGGATCTCTAGAGTCGACCTGCAGGCATGCAAGCTTATTGCATCCAAAAGAAAAAGACCTTTAAATTCGAAATATAGTCTCCT
AGACTAAGATATATTCTAGTAAACTAGACATACGTGGCCCGTGCTAGCATATCTTAGTAATTTTTAAAAGAAAATTTATGTGATATAAGTAGAATTTAGA
AAGTTGATTAAATTTTAATATGTTTTTTTTAGATATTCAAGATATTAATTATTTTTTGTTTGTGCAAATTTATTGTTAAGAGATCCATTAAGATGTCTAT
AATTAATGTATTTTTGTCATCGATCCTTAATTTTGTACTCAAAGTAATTATAAGATATAAATAAATATTTACAACATTCAAAATAATAATACAATAACTA
AAGAATATGAATTAAAAACTAAAAGTCATAACTAAAACAGATTTTATAATTTTGAAAAAATTATATACTAATTAAATTGAAGCAACCAGAAAAAGTAATT
TTAGAAAATAAATTTTTGAAACACGCTGAAGTGGGCACATCAACGTAGACATGTCTGCTTCAACACAAATTGTCTCTTATATAATAAGAAATTCAAAATA
ATAAATCAATAACTAAAAAATATGAATTTAAAACTAAAAGTCATTACTAAAACCGATTTTATAATTTTAAAAAAATTATACCCAAATTCAATTAAAGCAA
CCAAAAAAAATAATTTTAAAAAATAATTTTTTCAAACACGCTGAATCAGGCACGTCGAAAGAAACATGCCTTAGCTCAAATTGTCGAGGAATTATAAATG
GTTTTCTCATGCAAACAAACTTTTTGGCAAAATTAAAATTCTTTTTTTACAATTTGTTTAACACCAAAAAAAACCTAAAATGCAAAAAAATTCCTTTCTT
AATCCC
>LE_HBa0155O16_T7_201140 (trimmed for quality and cloning vector)
AGCTTATTGCATCCAAAAGAAAAAGACCTTTAAATTCGAAATATAGTCTCCTAGACTAAGATATATTCTAGTAAACTAGACATACGTGGCCCGTGCTAGC
ATATCTTAGTAATTTTTAAAAGAAAATTTATGTGATATAAGTAGAATTTAGAAAGTTGATTAAATTTTAATATGTTTTTTTTAGATATTCAAGATATTAA
TTATTTTTTGTTTGTGCAAATTTATTGTTAAGAGATCCATTAAGATGTCTATAATTAATGTATTTTTGTCATCGATCCTTAATTTTGTACTCAAAGTAAT
TATAAGATATAAATAAATATTTACAACATTCAAAATAATAATACAATAACTAAAGAATATGAATTAAAAACTAAAAGTCATAACTAAAACAGATTTTATA
ATTTTGAAAAAATTATATACTAATTAAATTGAAGCAACCAGAAAAAGTAATTTTAGAAAATAAATTTTTGAAACACGCTGAAGTGGGCACATCAACGTAG
ACATGTCTGCTTCAACACAAATTGTCTCTTATATAATAAGAAATTCAAAATAATAAATCAATAACTAAAAAATATGAATTTAAAACTAAAAGTCATTACT
AAAACCGATTTTATAATTTTAAAAAAATTATACCCAAATTCAATTAAAGCAACCAAAAAA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.862589
Expected error %
0.767749
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0155O16
Clone
Clone name
hba-155o16
LE_HBa0155O16
C02HBa0155O16
P155O16
Clone type
BAC
Contamination
none
Estimated length
120,543
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found