Clone Read LE_HBa0161D16_SP6_201379

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0161D16_SP6_201379
Primer
SP6
ID from Seq. Facility
LE_HBa_161_D16-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
277 trimmed for vector and quality, 797 raw
Sequence
>LE_HBa0161D16_SP6_201379 (raw untrimmed)
TTAAATTAAAAGTACGACGTCCCCCTTTAACAATTACACTNAGGCCAGGCGTTTTACAACAGTCGAGACTCGGGAAAACCCTTGGCGTTACCCAACTTAA
TCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGG
CGCCTGATGCGGTATCTTCTCCTTACGCATCTGTGCGGTATTTCACACCGCATATGGTGCACTCTCAGTACAATCTGCTCTGATGCCGCATAGTTAAGCC
AGCCCCGACACCCGCCAACACCCGCTGACGCGAACCCCTTGCGGCCGCATCGAATATAACTTCGTATCATGTATGCTATACGAAGTTATTAGCGATGAGC
TAGGACTTCCATTGTTCATTCCACAGACAAAAAAGGAGAAAGGAAATGCACATGGATATGGTCTGGTTAATGTGGTGTTTGTTCGGATTTTGTCACTCGG
ATTCATACATGATGTCTGATTTCAGACATAGATGAAGGTAATTGTAATACACTACCCAACCTACCACGATGTAAAAGGCGAAAATGATACTAGAGCAAAA
TAAATAATCGTCCATAATCAAGCAAACTAACTTCTCCAACCTTATCATATGTTGTCTGGTAACAGCAAACGACTAAAATTACTTTTTGCTTTTTATATTA
TGTGAGCTGGTGCTACTGATAAATAGAGATAACATTAGATGAAGGGGTGGAAGGTCAATGCGTGTCAACGTATTCTGACACCCCTCCCATTAACAAT
>LE_HBa0161D16_SP6_201379 (trimmed for quality and cloning vector)
GAAAACCCTTGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGCCCTTCCCAA
CAGTTGCGCAGCCTGAATGGCGAATGGCGCCTGATGCGGTATCTTCTCCTTACGCATCTGTGCGGTATTTCACACCGCATATGGTGCACTCTCAGTACAA
TCTGCTCTGATGCCGCATAGTTAAGCCAGCCCCGACACCCGCCAACACCCGCTGACGCGAACCCCTTGCGGCCGCAT

This is probably not a useful sequence.

Problems:
  • Probable foreign DNA contamination
Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.957828
Expected error %
0.277897
Sequence Annotations 
Automatic Annotations
NCBI UniVec vector sequences (screening/vector/UniVec)NCBI BLAST
gnl|uv|J01636.1:1-7477 Score 242 E Value 2e-65 Identity 99.20% Align. Length 129bp (46.57%) Frame 2
E.coli lactose operon with lacI, lacZ, lacY and lacA genes
NCBI UniVec vector sequences (screening/vector/UniVec)NCBI BLAST
gnl|uv|L09145.1:1626-1799 Score 226 E Value 9e-61 Identity 97.70% Align. Length 129bp (46.57%) Frame 2
pUR222 cloning vector
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
emb|CAA75110.1| Score 147 E Value 1e-34 Identity 32.90% Align. Length 206bp (74.37%) Frame 3
beta-galactosidase [Cloning vector pUC57]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAB68845.1| Score 147 E Value 1e-34 Identity 32.90% Align. Length 206bp (74.37%) Frame 3
beta-galactosidase alpha peptide [Cloning vector pUC-JK]
E. coli K12 Genome (E.coli_K12/Ecoli_genome)NCBI BLAST
gi|16127994|ref|NC_000913.1| Score 242 E Value 1e-64 Identity 99.20% Align. Length 129bp (46.57%) Frame 2
Escherichia coli K12, complete genome
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0161D16
Clone
Clone name
hba-161d16
LE_HBa0161D16
P161D16
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found