Clone Read LE_HBa0161D16_T7_201380

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0161D16_T7_201380
Primer
T7
ID from Seq. Facility
LE_HBa_161_D16-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
0 trimmed for vector and quality, 890 raw
Sequence
>LE_HBa0161D16_T7_201380 (raw untrimmed)
CTCGGTACCCGGGGGTATCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGAGTATTCTATAGTGTCACCTAACTTTCTTGGCGTAATCATGGTCATAGCT
GTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTC
ACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGAACCCCTTGCGGCCGCCC
GGGCCGTCGACCAATTCTCATGTTTGACAGCTTATCATCTAATTTCTGTCATTCATCCGCTTATTATCACTTATTCAGGCGTAATTACCAGGCTGTTTTA
CGGCACCAATAACTGTCTTAAAAAAATTACGCCCCGCCCCTGCCACTCATCGTAGTACTGTTGTATTGCTATGAATCGTGCTCCCTACTTGTTTGCCAAT
CTCCCACGGTATAATCATACATGAATCTTTAAATTTTATCACCTATCTAAACGTCTTTGCTTTATTATATCTTTAACTTCTTTTATATACTTTTTTTCTA
AGTAGTTGGTTCTATATGTCTCCTTTTTCTTATCTCGATTTTTTGTTCATTATTTCCTTTTTTCCATAGTTCTTTTTGATCTATTATCTAGTGTTTGTGT
TCTCTTCGTTCTCTAATCATCTTAATTTTGCTTTTTTTTCTTTTTTATCTTTCTTTTATTTTATTTTTTTATACTACCTTATATACTTTATCTTTTTTCC
TTTTGTCGTGTAATTTTTAAATATTATTTTTGAACTTATCGTTGTTTTACTTTATTTAACTCTTTTTGTTTTTATTGCTGCTTATTTTTT
>LE_HBa0161D16_T7_201380 (trimmed for quality and cloning vector)

This is probably not a useful sequence.

Problems:
  • Short cloning insert
  • High predicted error rate
  • Low complexity
  • Probable foreign DNA contamination
Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, no insert found (only flanking vectors)
Quality trim threshold
14.5
Sequence entropy
not recorded
Expected error %
100
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0161D16
Clone
Clone name
hba-161d16
LE_HBa0161D16
P161D16
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found