Clone Read LE_HBa0161H10_SP6_201559

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0161H10_SP6_201559
Primer
SP6
ID from Seq. Facility
LE_HBa_161_H10-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
231 trimmed for vector and quality, 725 raw
Sequence
>LE_HBa0161H10_SP6_201559 (raw untrimmed)
CGGTCTCTTTGCCTATCTTAGTTAGAGGCTTAATGTGTTAGTAGATAAACTATCCTCTACTAATTTAGCNGCCAGTCACAGCCAGCCTCCAGAAATTCAT
TTTTAGTATAAAATGGCTTAAACACCCAAAGCCAGCAAAGACCGTCATTGCATAGATAACTGCTCCTCTAACTAGGTGCATTAGCTGCACCAATGTTCTT
CCTTCTTGATTTTTCTAGCGTTGTTTTTTTCAATCAACGCAATACACTTGCTTTAGGAAAAAATTGTTGATATCATACCTAACGGGGGGAAAATAAGAAG
AAAAAGAGACATGTTGATACGTTATTTGACCTTTGAGAATTATTTTTAAATGTATTGACTCCAACATTTTGCCACTCTTGGTTATCTATTTATCCCGCCA
TATTCTTCTTCAGACAATTGGATCTTTCTACTATTCTCTTGCACTTCAAGTTGGTGTGAAGAACTGTAACATGCGTGCTATCTCATGATGATAAGTATGT
TCTCGTCATATTATCTTCCATTGTAGAACTATCCCTGCGAGAAAACCAAGTAATAATGCATACACATCACAGAGAGATTAAAATGATAAAATACTAAAAC
ATGAATAAGAGAAATAATGAAATAAGTGAGTCGAATGAGATAGTGGCGTATAATTATATAAAATTTCTACATATGTTGGTCATTCTAACGCTTTGTATGT
TATCTAGCTCCTTCAGTCCCTCCTC
>LE_HBa0161H10_SP6_201559 (trimmed for quality and cloning vector)
AGTCACAGCCAGCCTCCAGAAATTCATTTTTAGTATAAAATGGCTTAAACACCCAAAGCCAGCAAAGACCGTCATTGCATAGATAACTGCTCCTCTAACT
AGGTGCATTAGCTGCACCAATGTTCTTCCTTCTTGATTTTTCTAGCGTTGTTTTTTTCAATCAACGCAATACACTTGCTTTAGGAAAAAATTGTTGATAT
CATACCTAACGGGGGGAAAATAAGAAGAAAA

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.950159
Expected error %
0.567539
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0161H10
Clone
Clone name
hba-161h10
LE_HBa0161H10
C12HBa0161H10
P161H10
Clone type
BAC
Contamination
none
Estimated length
129,865
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found