Clone Read LE_HBa0161H10_T7_201560

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0161H10_T7_201560
Primer
T7
ID from Seq. Facility
LE_HBa_161_H10-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
485 trimmed for vector and quality, 854 raw
Sequence
>LE_HBa0161H10_T7_201560 (raw untrimmed)
CGGGGACCCGGGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTCAGTGGGAGAGCAAAGATGATCCTTTGATGAAGAAAAGCTTTCACTAACTA
TCAACAAAATACACCTTACAAGTGAATAAAACAAAAAGAGAATTCCCATCTTCTTTTTGCTTATTTTCAGCAAATAATAAGATGATGTTGCTAAATCAAT
CATCATAATATATATATATATATATATATACATGAAAAGGTAGTGTCAAGTGTGTACACATAACAACCAACTTTTCTGTTTTATAGTTGTTCACAACAAC
TATATCACACAAACAATCCATTTGAACTTCAGACATAAAATATATTAAAAAAAAGATATTGAGAGCTATTTTCTTACAAAGACTCTTAATTTAATTTATT
TTTAGTGTTTGAATTTTGCGATTTAATTTTTAGATGTTTTAGTAGATAGAGCTTAAAATGAATTATATATTTTCTATTATTTACAATTTATTAAAATGAA
AAAAACTAATTTATTTCTAAAAATTCATATAATGATGTTAATACAAATAGTTAATCTTTATGTATTTAGGAATTATATTTATTGGTTTTTTTCTATAAGT
ACATTTTTTGGTTAATAATTACTGTTGTTGAACCAAATAGTTGGTAAATAATGTATTCTGTACTTATATGTTCATGGTAAGAACCATATTCAAATATATT
GATAAAGATTAATTTAATTATATATTTAAAATGAAAAATAATAGATATTATATTCATGTGTTAAACTTACTTATATCTTATTTTCTTTCTCTTATTTGTT
CTGTTTTATGTCGTTGTTTTATATTTATATTTTTTTCTGTATCATATTTTTTTA
>LE_HBa0161H10_T7_201560 (trimmed for quality and cloning vector)
AGCTTCAGTGGGAGAGCAAAGATGATCCTTTGATGAAGAAAAGCTTTCACTAACTATCAACAAAATACACCTTACAAGTGAATAAAACAAAAAGAGAATT
CCCATCTTCTTTTTGCTTATTTTCAGCAAATAATAAGATGATGTTGCTAAATCAATCATCATAATATATATATATATATATATATACATGAAAAGGTAGT
GTCAAGTGTGTACACATAACAACCAACTTTTCTGTTTTATAGTTGTTCACAACAACTATATCACACAAACAATCCATTTGAACTTCAGACATAAAATATA
TTAAAAAAAAGATATTGAGAGCTATTTTCTTACAAAGACTCTTAATTTAATTTATTTTTAGTGTTTGAATTTTGCGATTTAATTTTTAGATGTTTTAGTA
GATAGAGCTTAAAATGAATTATATATTTTCTATTATTTACAATTTATTAAAATGAAAAAAACTAATTTATTTCTAAAAATTCATA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.884863
Expected error %
0.520389
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0161H10
Clone
Clone name
hba-161h10
LE_HBa0161H10
C12HBa0161H10
P161H10
Clone type
BAC
Contamination
none
Estimated length
129,865
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found