Clone Read LE_HBa0161H15_SP6_201569

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0161H15_SP6_201569
Primer
SP6
ID from Seq. Facility
LE_HBa_161_H15-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
311 trimmed for vector and quality, 777 raw
Sequence
>LE_HBa0161H15_SP6_201569 (raw untrimmed)
ACCCATTTGACTGTCTCTCTTATGCGGAGTGCTTACACTAGATTACAANATNCATCGCAATATATCGTTCACTCAAACAGAGCTTAACCTCAGTCAAAAG
TGGTGGTTAAAATTGCTCATAGATTATGACATGATCATTCTTTTCACCCAGGTAAGGCGAATATTGTTATTGATGTTTTAAGTAGATTGTCCATTAAAAG
TACCGTTCATCTTGAGGAAGGAAAAAAGGAACTAGCACAAGAAGTGTATAGACTTGCACGCCTAGGAGTCCAACTCATGGATTACACAAAAAGAGGGATA
GTGGTGACGAATGGGTTTGAGTTATCATTAGTGTCTATAGTGATAGAAAAGCAAGACCAAGATCTTATTTTGCTTGAATTGAAGGCAATTGTCCATAAGA
ATGGACATGATGAATTAATCAAGTTCTGGTACGTTCTAGAAGTGTCACAATATGGGAGCAGGTTCGAAATTTTAGACTTCTTTGTGCTCTATGATATGAA
TAGACTCGGCTAATACAACCATTATATCTTGACACGCGTCTCATTGCTTCTTTATTATAACTACCATTTCTCTTATATTCTTCTCTTACTCCTCTTTGTT
TATCTTTAGTTTCTTCTCCTTTTTCCTTTCTTGCTCTCCTTCTACCTTATCCTTGCTCCTGCTCTCTCCCAATTTTATCTGCTATCACTTGTATGAATAT
ATGCCACTTAGTATTGGTAGATGGATAGATTGACTTTCACTAAACCAGTCCCAAACATAACTTACTTATCTACCCAG
>LE_HBa0161H15_SP6_201569 (trimmed for quality and cloning vector)
CACTCAAACAGAGCTTAACCTCAGTCAAAAGTGGTGGTTAAAATTGCTCATAGATTATGACATGATCATTCTTTTCACCCAGGTAAGGCGAATATTGTTA
TTGATGTTTTAAGTAGATTGTCCATTAAAAGTACCGTTCATCTTGAGGAAGGAAAAAAGGAACTAGCACAAGAAGTGTATAGACTTGCACGCCTAGGAGT
CCAACTCATGGATTACACAAAAAGAGGGATAGTGGTGACGAATGGGTTTGAGTTATCATTAGTGTCTATAGTGATAGAAAAGCAAGACCAAGATCTTATT
TTGCTTGAATT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.950183
Expected error %
0.219611
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT38744.1| Score 95 E Value 1e-23 Identity 62.00% Align. Length 307bp (98.71%) Frame 3
putative gag-pol polyprotein [Solanum demissum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT38724.1| Score 95 E Value 6e-23 Identity 62.00% Align. Length 307bp (98.71%) Frame 3
putative retrotransposon protein [Solanum demissum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0161H15
Clone
Clone name
hba-161h15
LE_HBa0161H15
P161H15
Clone type
BAC
Contamination
none
Estimated length
96,041
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found