Clone Read LE_HBa0161H15_T7_201570

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0161H15_T7_201570
Primer
T7
ID from Seq. Facility
LE_HBa_161_H15-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
511 trimmed for vector and quality, 881 raw
Sequence
>LE_HBa0161H15_T7_201570 (raw untrimmed)
TCCGGACCCGGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTAAGGAAAACATAAAAGAAAATAACAGGGAGGCGTGGGAATCGAACCCATGAC
CCCTAGGTATAAAAGCATAATTAAAATAAAAATAAATTGAGGTTGTGTGGGTTAGATCACAAAACCTCACGGTCAACTCAGAAAAGTCAAGATCGAATGA
AAATAACATAATGAGGCTGTGGAGGATCTATCCCACAACCTCTTCGTCCCCCAACGGATAAAAGAAAAAGAAAAAACAAAGAAAAAAATAAATAGCAATG
TTGGGGATCGATCTCGGGTCCAATATTGTGTGACCAAAAATAATTAAAAAGAGACATGTAAGTGTTGTCCAAGGATCGAAATCAGGTTCCCTTCCCCAAA
TTTCCGTCGTGATAATAACTCATACGTGAAAATATTTACAATATTATGTTGCCTGCATAGATTGGAACCGATATTTTGGCATACATACAAGATTCATAAT
TCTTGTACTACATAATCTTGGGAAGATATGAATCACTTTAACAAACTATGAATTAATGGCTCATGCCTTGTTTGAATACTACCCATATTTTATCTACATT
CACATTCTATTTTAACCCTACCTTTTTCTAATTCAAAATAACACATATTAATATTCATAATATTCAATCCTTCTAACTGTTTATTCTAAACTCTTAAATT
CATTATCCTGTAATATGTTTAATTACTATTCTTTTATCATTACATAGATTCTTATTTACCTTGTCATATGCCTATATTTTTACTATTTCTTTTTCTTTAT
TCTTTCACTTTATTCTTTCATATTTTTCTATATTTTATTATAACCTATATTTATCATATTCATATTTACTTTTTCTATTTT
>LE_HBa0161H15_T7_201570 (trimmed for quality and cloning vector)
AGCTTAAGGAAAACATAAAAGAAAATAACAGGGAGGCGTGGGAATCGAACCCATGACCCCTAGGTATAAAAGCATAATTAAAATAAAAATAAATTGAGGT
TGTGTGGGTTAGATCACAAAACCTCACGGTCAACTCAGAAAAGTCAAGATCGAATGAAAATAACATAATGAGGCTGTGGAGGATCTATCCCACAACCTCT
TCGTCCCCCAACGGATAAAAGAAAAAGAAAAAACAAAGAAAAAAATAAATAGCAATGTTGGGGATCGATCTCGGGTCCAATATTGTGTGACCAAAAATAA
TTAAAAAGAGACATGTAAGTGTTGTCCAAGGATCGAAATCAGGTTCCCTTCCCCAAATTTCCGTCGTGATAATAACTCATACGTGAAAATATTTACAATA
TTATGTTGCCTGCATAGATTGGAACCGATATTTTGGCATACATACAAGATTCATAATTCTTGTACTACATAATCTTGGGAAGATATGAATCACTTTAACA
AACTATGAATT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.933067
Expected error %
0.861467
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0161H15
Clone
Clone name
hba-161h15
LE_HBa0161H15
P161H15
Clone type
BAC
Contamination
none
Estimated length
96,041
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found