Clone Read LE_HBa0161I14_T7_201616

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0161I14_T7_201616
Primer
T7
ID from Seq. Facility
LE_HBa_161_I14-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
281 trimmed for vector and quality, 956 raw
Sequence
>LE_HBa0161I14_T7_201616 (raw untrimmed)
GCGGGGCCCGGGGGGAATCTCTAGAGTCGACCTGCAGGCATGCAAGCTTCTTCCTAACTATCTCAATTTGCCATGATGTTATATTAAAGGCCTACGATGT
AAAGTCACCTGCATTATCAAGACGGATTTTCTTTCTTGCATTATTTGGAAATTATGCTCTTAATCTTATTATTTGAGCTAACAACCTCGCAAAAGTCATA
CTGCGAGTTGACAATATGCACATATGACCATCTTATTTATGCATCTATCAAGATCATACAATATTTAACGGCCCACATATATCATCCTGTATACATTACA
GAAATGCAGGGGATTCAATCCCAACCCTAGCTGTTGAAGGTTTAAAAATCTACTCTCTTTCTGAAGAATCTGTTCTCTAAAATCTCTTTTTTGAGTTCAG
TCTTCGATTGAGGTCTATTCCTCTCAAGTTAATGTATATACTTTTATTCTTACTCTGTTTTTACTTTTTTTTTTCGTTGACTATTCTGTCTCTTTTTACT
TATCTACATATTTCATTATATTACAGTGCTTATTATTGTGATTTTTTTCTAATTTTTTTATTTTATCTTCTTTATTTATGTATTCTCTCTTTTCTTGGCT
AAGTACACTTATTGATAATCCTCTTGTGTTCCATGTTCGAGTACTAGTGCTTTGGGCGTGTTCTTTTTTTGCCTATGCTCTTCGTGAACTGCGCTGTGAT
TACCTCAAGTTAATGATGACTGCATTGTGTTTCAAGAGCTGCACTGCGTTATGGTGATATGGGTTTGATTGGGCTCGCTCTGTCTGTTTGTTCTAATGCA
GTGTGTGGGTCTTCTTGGCTTTCTTGTTACTCCTTGGTACTCATCCGCTCTGTGCACATCATCACTTGGCATTCTGTTACTTTCTTCAGTTGATGACCCC
GCTAACGCTCCCTCCGCCAACGCTATTATCAAGTCACGCTCGTATAGATAACTGTA
>LE_HBa0161I14_T7_201616 (trimmed for quality and cloning vector)
AGCTTCTTCCTAACTATCTCAATTTGCCATGATGTTATATTAAAGGCCTACGATGTAAAGTCACCTGCATTATCAAGACGGATTTTCTTTCTTGCATTAT
TTGGAAATTATGCTCTTAATCTTATTATTTGAGCTAACAACCTCGCAAAAGTCATACTGCGAGTTGACAATATGCACATATGACCATCTTATTTATGCAT
CTATCAAGATCATACAATATTTAACGGCCCACATATATCATCCTGTATACATTACAGAAATGCAGGGGATTCAATCCCAAC

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.946955
Expected error %
0.74371
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0161I14
Clone
Clone name
hba-161i14
LE_HBa0161I14
P161I14
Clone type
BAC
Contamination
none
Estimated length
125,626
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found