Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

Clone Read LE_HBa0171B21_T7_202017

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0171B21_T7_202017
Primer
T7
ID from Seq. Facility
LE_HBa_171_B21-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
359 trimmed for vector and quality, 734 raw
Genbank Accession
Sequence
>LE_HBa0171B21_T7_202017 (raw untrimmed)
TGGTGAGAGCGAAGAATATTCCCCCTTTTACCATATTCACCATCGACCCAATCTACCATTATGCCCCCTCCCCCCATGTGTAAACTTCAGTTCGGGAAGT
CAAGACAGCAACATGATATGCTCCACAGGCGATCTCCTCCACAAAACTCTTTGCCAGCTTGCCTTCAACACGACGGGGTAACTTCCCATCAGCTTGGCGA
TGACCTAATTGGCCATACACAGGACTTCCCATTGTATACAAATGACCAGAAGTCGTCAATGCAACTGTCAAGCTGTGTCCACAAGCAACTTGGCAAAAGT
TTGGTTCGACAAGAGCTGCAACACAGGTAGGTACAAGTTTCGACTCCTTGTCACCATGCCCTAGTCTACCTTTATCACCATCTCCCCAAGTAAAAAGTTT
TCCTGATGAACAATTACTTGAACTTCGATCTTCCCACCATGACTTCTACGAACGCTATATTATTTTAACAACCTCAAAAGTTTCTTACATTTAATTGAAC
GCCCCTAAAACAACCTTCATCCTCCTCTTTCTATTATACCCAATTTTTTTCATTTTTTCTTCTTAATACTTCACCTATAAGATCACTTTACTTACAATTC
CTAAAAACCACCTTATTTAATCCACCTCTATCTCTCCCTTCGCCTTCTCTCCGGGCTATCTCACCCCAATACATTAAACATGGGACTTCCCCATGGACGA
TGGATCTATTAATATTTTTTTCGCGCGATCTTAG
>LE_HBa0171B21_T7_202017 (trimmed for quality and cloning vector)
ACCCAATCTACCATTATGCCCCCTCCCCCCATGTGTAAACTTCAGTTCGGGAAGTCAAGACAGCAACATGATATGCTCCACAGGCGATCTCCTCCACAAA
ACTCTTTGCCAGCTTGCCTTCAACACGACGGGGTAACTTCCCATCAGCTTGGCGATGACCTAATTGGCCATACACAGGACTTCCCATTGTATACAAATGA
CCAGAAGTCGTCAATGCAACTGTCAAGCTGTGTCCACAAGCAACTTGGCAAAAGTTTGGTTCGACAAGAGCTGCAACACAGGTAGGTACAAGTTTCGACT
CCTTGTCACCATGCCCTAGTCTACCTTTATCACCATCTCCCCAAGTAAAAAGTTTTCCT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.966229
Expected error %
0.716928
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At5g12350.1 Score 220 E Value 1e-58 Identity 90.40% Align. Length 341bp (94.99%) Frame 3
68418.m01453 zinc finger protein, putative / regulator of chromosome condensation (RCC1) family protein similar to zinc finger protein [Arabidopsis thaliana] gi|15811367|gb|AAL08940
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At5g19420.1 Score 218 E Value 3e-58 Identity 89.50% Align. Length 341bp (94.99%) Frame 3
68418.m02314 zinc finger protein, putative / regulator of chromosome condensation (RCC1) family protein similar to zinc finger protein [Arabidopsis thaliana] gi|15811367|gb|AAL08940
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
emb|CAC42896.1| Score 220 E Value 1e-56 Identity 90.40% Align. Length 341bp (94.99%) Frame 3
putative protein [Arabidopsis thaliana] ref|NP_568268.1| zinc finger protein, putative / regulator of chromosome condensation (RCC1) family protein [Arabidopsis thaliana]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
ref|NP_197443.2| Score 218 E Value 3e-56 Identity 89.50% Align. Length 341bp (94.99%) Frame 3
zinc finger protein, putative / regulator of chromosome condensation (RCC1) family protein [Arabidopsis thaliana]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0171B21
Clone
Clone name
hba-171b21
LE_HBa0171B21
C04HBa0171B21
P171B21
Clone type
BAC
Contamination
none
Estimated length
101,281
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found