Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

Clone Read LE_HBa0171J11_T7_202199

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0171J11_T7_202199
Primer
T7
ID from Seq. Facility
LE_HBa_171_J11-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
481 trimmed for vector and quality, 856 raw
Genbank Accession
Sequence
>LE_HBa0171J11_T7_202199 (raw untrimmed)
TCGGTCCCGGGGGTACCTCCTAGAGTCGACCTGCAGGCATGCAAGCTTCATACATCTATTTAAGTGTGTGCGTGTGTGTACTTTTCAGCACATCTTGCAT
ATAAGCATCATTTCATTCACATTAGCTTCTACACATGCTTTATACCTACATTCATCAATTCACATACTTTACATGCTTCACAAAATCATATACCACAATA
GGAATAATATAAGCCAAACATGCAATTAAACTTCACAAAACACAAGACAAGACTTATCTTCATTATAACTTCACTTCATATATCAGTCACGAAACATAGT
TAGTAATATCAAGTTCACTATATAAACACTACCACCAAGAAGGTGGACCATACCACTCAAGAGCAATTTGTCATAACAATTAAACAATATAAACAACTCA
CCATATAACCAAGTCATCACCACCTATAACCAATTTCTCAATATTTGATCATACTAAGATCCTAAGGACAGTGTTTAAACCAACACACATGCTCATTTAG
CCCATTTCTTACCAAAAGTTTGAAATATGCCATTACCTGAGTTAACTAGGTTTTTTTAAAACAAAAAACCTCACTACATACTAAAAATATATCTGTTTTA
TCAATTTAACATAATTATAAAAATAACCCATGCTTATAATACAAAGACAGAACGAAATATTGGTTGGAAAATCCCTTTGTTTAATCTTATGCAAAATTAC
TCCCTGCTAAATACAAATGGTACCAAGTGGAGGGATGCCTATTCATTTATACAATATAATTATTCTCTTTACTTTATGCTAATATAATTTTGACTTGCCG
TTCCTCCCTTTTTCTTCCCTATTTCTCTGCTTCTGTACATGGCAGAGAATAAAAAA
>LE_HBa0171J11_T7_202199 (trimmed for quality and cloning vector)
AGCTTCATACATCTATTTAAGTGTGTGCGTGTGTGTACTTTTCAGCACATCTTGCATATAAGCATCATTTCATTCACATTAGCTTCTACACATGCTTTAT
ACCTACATTCATCAATTCACATACTTTACATGCTTCACAAAATCATATACCACAATAGGAATAATATAAGCCAAACATGCAATTAAACTTCACAAAACAC
AAGACAAGACTTATCTTCATTATAACTTCACTTCATATATCAGTCACGAAACATAGTTAGTAATATCAAGTTCACTATATAAACACTACCACCAAGAAGG
TGGACCATACCACTCAAGAGCAATTTGTCATAACAATTAAACAATATAAACAACTCACCATATAACCAAGTCATCACCACCTATAACCAATTTCTCAATA
TTTGATCATACTAAGATCCTAAGGACAGTGTTTAAACCAACACACATGCTCATTTAGCCCATTTCTTACCAAAAGTTTGAA

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.909364
Expected error %
0.984538
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0171J11
Clone
Clone name
hba-171j11
LE_HBa0171J11
P171J11
Clone type
BAC
Contamination
none
Estimated length
126,651
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found