Clone Read LE_HBa0171P18_T7_202350

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0171P18_T7_202350
Primer
T7
ID from Seq. Facility
LE_HBa_171_P18-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
709 trimmed for vector and quality, 765 raw
Genbank Accession
Sequence
>LE_HBa0171P18_T7_202350 (raw untrimmed)
CCTGGTACCCGGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTCATTATTCACCTTCTTTTCAACTTAAGGTTTCACATTCTTAACCTTCTTGT
CAAATTCAAGGTCTCACATAAGTCATTTATAGAAGGATACCACTTTAGGCCTACCGATCCTAGACTTTCATTTATTCATATATACATGACAAGGGTTCCT
ACGCCTACCAATATAGGAGATCATATTCGCATAACCTTCATGAATCAAGTAGGGACAACTAGGTTGACCTAAATAAGACACCATATAGACCTATAAAGAC
TCTTTATAGTCTATCATCATCACATACCAACACTTAGAGTAATATACTCTCAATCACAATATCACATAGCTTTATCATGACCACCTCAATATCATATAAA
CACCTTCACATTATGAACATAAAAGAAGATCACCCACATATCACATAATAACTTCAGTTTATGCATTCATGTATGACATAACAACTTTCACATTGTAACA
TTACTTCGTATAAATAACTTTACGTTACACCTTCATATATACCTGAATATGATAATACTACAGTTCACATAATAATGCCAACAATTCCATGATTACAATA
ATAATAAGAAGTAAATACCACCACAATAAGTGGACCATACCACACAAGAGCATTTTTATATCAATTCTTCATTAGTAAAGGAATTATTTCAACTTAACCT
CTTCCCATAGCCAAGATCACCATTTCTTAACATATACATCAATTCACAATATAATAGCATAATTA
>LE_HBa0171P18_T7_202350 (trimmed for quality and cloning vector)
AGCTTCATTATTCACCTTCTTTTCAACTTAAGGTTTCACATTCTTAACCTTCTTGTCAAATTCAAGGTCTCACATAAGTCATTTATAGAAGGATACCACT
TTAGGCCTACCGATCCTAGACTTTCATTTATTCATATATACATGACAAGGGTTCCTACGCCTACCAATATAGGAGATCATATTCGCATAACCTTCATGAA
TCAAGTAGGGACAACTAGGTTGACCTAAATAAGACACCATATAGACCTATAAAGACTCTTTATAGTCTATCATCATCACATACCAACACTTAGAGTAATA
TACTCTCAATCACAATATCACATAGCTTTATCATGACCACCTCAATATCATATAAACACCTTCACATTATGAACATAAAAGAAGATCACCCACATATCAC
ATAATAACTTCAGTTTATGCATTCATGTATGACATAACAACTTTCACATTGTAACATTACTTCGTATAAATAACTTTACGTTACACCTTCATATATACCT
GAATATGATAATACTACAGTTCACATAATAATGCCAACAATTCCATGATTACAATAATAATAAGAAGTAAATACCACCACAATAAGTGGACCATACCACA
CAAGAGCATTTTTATATCAATTCTTCATTAGTAAAGGAATTATTTCAACTTAACCTCTTCCCATAGCCAAGATCACCATTTCTTAACATATACATCAATT
CACAATATA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.913509
Expected error %
0.495709
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0171P18
Clone
Clone name
hba-171p18
LE_HBa0171P18
P171P18
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found