Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

Due to a hardware issue, SGN was briefly unavailable earlier today. We apologize for any inconvenience.

Clone Read LE_HBa0174E04_SP6_202555

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0174E04_SP6_202555
Primer
SP6
ID from Seq. Facility
LE_HBa_174_E04-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
716 trimmed for vector and quality, 780 raw
Sequence
>LE_HBa0174E04_SP6_202555 (raw untrimmed)
GTTTGTTTTTCTTCCTCATAGCTGCCACTCATCCCTTGTCCTTGACAGCTTGGTAATTAAATGAGGCTCCTTTTTAACTGAAAGATTAGAAATGCAACAT
TGATATGAAACCTACAAGCAGTTGTAGTCAATACTATCTCCAAGAGAGTACAGACAGTGAGGCTTTGATATAGACTTAGCTGAGGTCACAAAATCCTTTT
GCCAAAGTGGAGGTCTGGAAGTTCTAGTGGACTGTCTTTTTCCTATAGTGGAACTCATAGTTGGTTCCTGAACAACTGAAGATGGAATCATATTTGGCTC
CTCAAGAATATGATCAACAAAGTGTCTAGTGGTACTATCAGTATGATCATTCATGCAAACATGATCATCAGCCTTGACATTCAAAACTGGAATTGAAACT
TGAATTGCATCATCTAGTACAATTGCCTGCATATCTGCATTAACATGAATGTGAAAGGGAAATATGGATTCCGTAAAAACAACATCCCTGCTGATAAAAA
AAACTTTATTTTCAAGATCATAAAGTTTGTATCCCTTTTGTGTAGTGCCATAACCCATAAAAACTGATCTAATAGCTCTACGTCCAAACTTGTGTGTCCT
CAACAGTTTGGTGGCATGACATAATCAACCTATTATTCTCATGTAAGACAGATTTGGTGGTTTGCTGAACATCATCTCAAAAGGAGACTTATTATCCAAC
ACAGTGGATGGAATTCTATTAATAATATGATCTGCAGCATAAACACACTCCCCCCAAAACTTGATTTCGAATGTGACCTT
>LE_HBa0174E04_SP6_202555 (trimmed for quality and cloning vector)
AGCTGCCACTCATCCCTTGTCCTTGACAGCTTGGTAATTAAATGAGGCTCCTTTTTAACTGAAAGATTAGAAATGCAACATTGATATGAAACCTACAAGC
AGTTGTAGTCAATACTATCTCCAAGAGAGTACAGACAGTGAGGCTTTGATATAGACTTAGCTGAGGTCACAAAATCCTTTTGCCAAAGTGGAGGTCTGGA
AGTTCTAGTGGACTGTCTTTTTCCTATAGTGGAACTCATAGTTGGTTCCTGAACAACTGAAGATGGAATCATATTTGGCTCCTCAAGAATATGATCAACA
AAGTGTCTAGTGGTACTATCAGTATGATCATTCATGCAAACATGATCATCAGCCTTGACATTCAAAACTGGAATTGAAACTTGAATTGCATCATCTAGTA
CAATTGCCTGCATATCTGCATTAACATGAATGTGAAAGGGAAATATGGATTCCGTAAAAACAACATCCCTGCTGATAAAAAAAACTTTATTTTCAAGATC
ATAAAGTTTGTATCCCTTTTGTGTAGTGCCATAACCCATAAAAACTGATCTAATAGCTCTACGTCCAAACTTGTGTGTCCTCAACAGTTTGGTGGCATGA
CATAATCAACCTATTATTCTCATGTAAGACAGATTTGGTGGTTTGCTGAACATCATCTCAAAAGGAGACTTATTATCCAACACAGTGGATGGAATTCTAT
TAATAATATGATCTGC

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.95588
Expected error %
0.328233
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAU89728.1| Score 172 E Value 6e-42 Identity 14.40% Align. Length 671bp (93.72%) Frame 1
putative retroelement pol polyprotein-like [Solanum tuberosum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAU93584.1| Score 120 E Value 3e-26 Identity 11.00% Align. Length 662bp (92.46%) Frame 1
putative polyprotein [Solanum demissum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0174E04
Clone
Clone name
hba-174e4
LE_HBa0174E04
P174E04
Clone type
BAC
Contamination
none
Estimated length
98,788
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found