Clone Read LE_HBa0174H02_SP6_202695

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0174H02_SP6_202695
Primer
SP6
ID from Seq. Facility
LE_HBa_174_H02-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
648 trimmed for vector and quality, 775 raw
Sequence
>LE_HBa0174H02_SP6_202695 (raw untrimmed)
GTTTTGGGATCGAAAGAGTATTTGAAAGACCTTCTACATAAAGGCTTCATCAGACCTAGTATTTCACCACCTTTGTGCACCAGTGTTGTTCGTAAAGAAG
AAAGATGGTTCACTTAGAATGTGCATTGACTATAGACAGGTAAACAAAGTCACAGTTAAGAATAGGTATCCCATCCCCAGAATTGATGACTTGTGTGACC
AAATTCAGGGTGCTAGCCATTTCGCAAAGATAAACCTCAGATCGAGTTATCATCACCTCACTGTCAGAAATAGTGACATTCTGAAAACCGCCTTCAGAAC
TTGGTGTGGTCATTATGAATTTGTAGTTATGTCTTTTGGACTAAATAGTTTTTCTATAGCTTTCATGGATTTGATTAACAGAATGTTCAAAAAGTACTTG
GACTTGTTCGTTATCGTGTTTATTGATGATATCCTCATTTACTCTAGGAGTAAGGAAGAACATGAAAGTCATTTGAGAGTTATTCTACAGACTCTTAAAG
ATCCCCTATTTTTTGCTAAGTTTAGAAAATTTGAGTTCTTGTTGCAATCCGTTGCTTTTCTTGGTCACATGGTATCTAGAGAAGGGATCCTAGTAGATTC
ACAGAAGATAGAAACACTGAAGCAGTGGCCCATACCTACCTCCTGCTACAGATATCAAAATTTTTTTAGGTCTAACGGATTATTACAAAAGGTTCGTGGA
AGGATTTTTCATCCATAATCCCTCACCCATTTACTAAGGTTGAACTCAAAAAATGGCCAAATTTCCAATGTGCCA
>LE_HBa0174H02_SP6_202695 (trimmed for quality and cloning vector)
TGAAAGACCTTCTACATAAAGGCTTCATCAGACCTAGTATTTCACCACCTTTGTGCACCAGTGTTGTTCGTAAAGAAGAAAGATGGTTCACTTAGAATGT
GCATTGACTATAGACAGGTAAACAAAGTCACAGTTAAGAATAGGTATCCCATCCCCAGAATTGATGACTTGTGTGACCAAATTCAGGGTGCTAGCCATTT
CGCAAAGATAAACCTCAGATCGAGTTATCATCACCTCACTGTCAGAAATAGTGACATTCTGAAAACCGCCTTCAGAACTTGGTGTGGTCATTATGAATTT
GTAGTTATGTCTTTTGGACTAAATAGTTTTTCTATAGCTTTCATGGATTTGATTAACAGAATGTTCAAAAAGTACTTGGACTTGTTCGTTATCGTGTTTA
TTGATGATATCCTCATTTACTCTAGGAGTAAGGAAGAACATGAAAGTCATTTGAGAGTTATTCTACAGACTCTTAAAGATCCCCTATTTTTTGCTAAGTT
TAGAAAATTTGAGTTCTTGTTGCAATCCGTTGCTTTTCTTGGTCACATGGTATCTAGAGAAGGGATCCTAGTAGATTCACAGAAGATAGAAACACTGAAG
CAGTGGCCCATACCTACCTCCTGCTACAGATATCAAAATTTTTTTAGG

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.963341
Expected error %
0.30423
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT38744.1| Score 276 E Value 4e-76 Identity 68.40% Align. Length 639bp (98.61%) Frame 1
putative gag-pol polyprotein [Solanum demissum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT38724.1| Score 275 E Value 1e-75 Identity 67.90% Align. Length 639bp (98.61%) Frame 1
putative retrotransposon protein [Solanum demissum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0174H02
Clone
Clone name
hba-174h2
LE_HBa0174H02
C02HBa0174H02
P174H02
Clone type
BAC
Contamination
none
Estimated length
103,429
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found