Clone Read LE_HBa0174H02_T7_202696

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0174H02_T7_202696
Primer
T7
ID from Seq. Facility
LE_HBa_174_H02-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
724 trimmed for vector and quality, 769 raw
Sequence
>LE_HBa0174H02_T7_202696 (raw untrimmed)
ACTCGGGTACCGGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGTACAAACATCCATAGTGGTCGATTTCCGAGCTAGGTTTGAAGCTATCTC
TAATGATACGATCTACTTGCCTGATGAGTTTTTGTTTAGGTTTTTTTATTTCGGGCCTCCGATTGGATATTCAGGATGAAGTCACTATTTGAGAGCCCAC
TTCCTAAGAAAATGCCATACGTTTAGCCCAAATGTATGAGCAGAAGTTTAACTATGCTAAAGGCCCGATTTGTCCTGCTTTTGCGGGAAGTCAACCCCTT
TTACCGATCCTACTACTTCGTCTCCTATGACTCTATCTAAACCAGCTGTTACTCCATCTATCTTTTCTAAAATTCCCTTCAAGCGTCTTTCAGCCTTTGA
GCTCCAGGCTAGACGAAAAAAGGGTTGTTCTACAATTATGATTAGAAATACACCATTGGACACAAATGCAAGGAACTTCCTTAGTTACTAGTTTTGGAGG
AGTCATTTGAATCCTCAATTAAGTTACCCGAGTCTTTTTGTCCTGAGGATTTCATAGCAGAAGAACTACAATGCTTGGAGGTTCGAGCTCATTCCACTAT
TTCTTATCACGCTTTGTTTGGTGGTACATCTCATGCTACCCTCGCTTTAATGGTCATGTACAGGGTTCCCCAGTGCAAGTGTTGGTCGATGGCGGAGCAC
AAATAACTTTGTGCAAGCGGGAGTTGCGAAAATTCTAAATATGTCTATTGAGCGAACACCTTCATTTAG
>LE_HBa0174H02_T7_202696 (trimmed for quality and cloning vector)
AGCTTGTACAAACATCCATAGTGGTCGATTTCCGAGCTAGGTTTGAAGCTATCTCTAATGATACGATCTACTTGCCTGATGAGTTTTTGTTTAGGTTTTT
TTATTTCGGGCCTCCGATTGGATATTCAGGATGAAGTCACTATTTGAGAGCCCACTTCCTAAGAAAATGCCATACGTTTAGCCCAAATGTATGAGCAGAA
GTTTAACTATGCTAAAGGCCCGATTTGTCCTGCTTTTGCGGGAAGTCAACCCCTTTTACCGATCCTACTACTTCGTCTCCTATGACTCTATCTAAACCAG
CTGTTACTCCATCTATCTTTTCTAAAATTCCCTTCAAGCGTCTTTCAGCCTTTGAGCTCCAGGCTAGACGAAAAAAGGGTTGTTCTACAATTATGATTAG
AAATACACCATTGGACACAAATGCAAGGAACTTCCTTAGTTACTAGTTTTGGAGGAGTCATTTGAATCCTCAATTAAGTTACCCGAGTCTTTTTGTCCTG
AGGATTTCATAGCAGAAGAACTACAATGCTTGGAGGTTCGAGCTCATTCCACTATTTCTTATCACGCTTTGTTTGGTGGTACATCTCATGCTACCCTCGC
TTTAATGGTCATGTACAGGGTTCCCCAGTGCAAGTGTTGGTCGATGGCGGAGCACAAATAACTTTGTGCAAGCGGGAGTTGCGAAAATTCTAAATATGTC
TATTGAGCGAACACCTTCATTTAG

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.978687
Expected error %
0.501991
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0174H02
Clone
Clone name
hba-174h2
LE_HBa0174H02
C02HBa0174H02
P174H02
Clone type
BAC
Contamination
none
Estimated length
103,429
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found