Clone Read LE_HBa0174L04_SP6_202891

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0174L04_SP6_202891
Primer
SP6
ID from Seq. Facility
LE_HBa_174_L04-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
664 trimmed for vector and quality, 786 raw
Sequence
>LE_HBa0174L04_SP6_202891 (raw untrimmed)
GTTGGAACCGAATACAGGTGTGTAGCTAGCTTTTTTTCCTTTTAACACGGACAGAGAAATTATAAAGCTGAAGAAACAAACAGTAATCTTCGTTAATAGA
ATGTGTCTTGTGTATGACTTGGTATCTTTATGTGTGCATGTTTTCATATTCTTTCTAAAGAGATAACATTTCCATCTTTCTTGTTTAATAATCTAATCTT
CAAGTACAAAATCATGATTTACTTGATGTTAACCGTTGGTTGATGGTTCACTGATTTATTTAGTCATAGATACGAGATGTTAGTATTTAGTGTAAGACTA
GTACACATTATGGAGTTGAGGAGCCGGACCACTTTATATATGATGTGTATATATTTTTTATTGAGACTTTTAATTTGTTTCTAATTCATATAACGTATGC
ATCCATCCATCCATCAGGCACAGAAAGCAGAAAGGGACTCTACAGATCTTAAAGGTTCAATGAGGAAGAGGATGGAATTTCTTGATATGGATTAAAGGTT
TACTGTTGTTTACGATAATTCCATGTCTTCTGCAAATATTATCGCAGTTGCTGCGTGGCGTTCGTTTTCTCCTGGGATATTCTGTGTTCATTTGTAACAT
GTGTTTCTTTTATGACGTTTGAGTAAAGGTTACTGGTGTTAAGACATGGTGAATGGGGAAACAAGTGTTTGAGTTGTTCCCATTTCCCGTCCTTTATGCT
AATCTGGAGGAATTGTAGTTTTTAAGTTAGACTCTGTATATGCTGTTGAATGGGTAGTTCCCGGTTTTTGCCTTTTTTTCCAATGT
>LE_HBa0174L04_SP6_202891 (trimmed for quality and cloning vector)
GCTAGCTTTTTTTCCTTTTAACACGGACAGAGAAATTATAAAGCTGAAGAAACAAACAGTAATCTTCGTTAATAGAATGTGTCTTGTGTATGACTTGGTA
TCTTTATGTGTGCATGTTTTCATATTCTTTCTAAAGAGATAACATTTCCATCTTTCTTGTTTAATAATCTAATCTTCAAGTACAAAATCATGATTTACTT
GATGTTAACCGTTGGTTGATGGTTCACTGATTTATTTAGTCATAGATACGAGATGTTAGTATTTAGTGTAAGACTAGTACACATTATGGAGTTGAGGAGC
CGGACCACTTTATATATGATGTGTATATATTTTTTATTGAGACTTTTAATTTGTTTCTAATTCATATAACGTATGCATCCATCCATCCATCAGGCACAGA
AAGCAGAAAGGGACTCTACAGATCTTAAAGGTTCAATGAGGAAGAGGATGGAATTTCTTGATATGGATTAAAGGTTTACTGTTGTTTACGATAATTCCAT
GTCTTCTGCAAATATTATCGCAGTTGCTGCGTGGCGTTCGTTTTCTCCTGGGATATTCTGTGTTCATTTGTAACATGTGTTTCTTTTATGACGTTTGAGT
AAAGGTTACTGGTGTTAAGACATGGTGAATGGGGAAACAAGTGTTTGAGTTGTTCCCATTTCCC

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.948621
Expected error %
0.0386995
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0174L04
Clone
Clone name
hba-174l4
LE_HBa0174L04
C03HBa0174L04
P174L04
Clone type
BAC
Contamination
none
Estimated length
60,781
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found