Clone Read LE_HBa0174O05_T7_203038

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0174O05_T7_203038
Primer
T7
ID from Seq. Facility
LE_HBa_174_O05-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
655 trimmed for vector and quality, 768 raw
Sequence
>LE_HBa0174O05_T7_203038 (raw untrimmed)
ACCCGGGACCCGGGAGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTTTTCTCCCTTAACATTTCCCCCCTTGAGGGCGCCNGCNCCNCANGNNCCN
CCNNACNNNCACCTTTAGGAGGANGNCANCAANAAAGACAANCACAAAGAGAANCAAAGANGGCCCAAAAANCCCGCNCANCAAACACANGAACGCAGCA
GGGGCANNCGNAAGACCAAAANACANCACNACAAACACGNAAAGCCCANACCAGGAACNAAAAGNAGACAAGGGCACANCCGANGCCCGAACGANAAAAG
GACGAAAACCGGACCNCAAGACAAGCNCAGAGAAGACACAAGCACCNNGCAACNAANCGAACAAGGCANCAAGGCGAGGAAGAGGAAACNNGCNCNNNAC
GGNNACCCNGCNCAACCGCCGGNAGNCNACGGACANCCGAAAACACCCANCCACCCACNNNACAAACAAAACGGGAGCACCCCAAGGANANGCACNCGGN
CNAANGAAGCCNNNGCNCAACAACNCANGAAGNNGGGCAAANAACACCCANAACNCCGAGGGAACCANNCNANAAGGGGGNANAGAAANGGGGCGAGAGC
CCGGGNCAAGAACAANACAGAAGNCAANANCCCNAACCGGCGGCACACCAGGAAGAACAGCAGGGAACACANCCAGAAACCCACGGACCACCGAAACCGA
CNCAAACGAAGGGACANGGGGAGGGACACCCAAGAGAAGGGCCCAGAAAGCAAAACACCCCGAAACAA
>LE_HBa0174O05_T7_203038 (trimmed for quality and cloning vector)
AGCTTTTTCTCCCTTAACATTTCCCCCCTTGAGGGCGCCNGCNCCNCANGNNCCNCCNNACNNNCACCTTTAGGAGGANGNCANCAANAAAGACAANCAC
AAAGAGAANCAAAGANGGCCCAAAAANCCCGCNCANCAAACACANGAACGCAGCAGGGGCANNCGNAAGACCAAAANACANCACNACAAACACGNAAAGC
CCANACCAGGAACNAAAAGNAGACAAGGGCACANCCGANGCCCGAACGANAAAAGGACGAAAACCGGACCNCAAGACAAGCNCAGAGAAGACACAAGCAC
CNNGCAACNAANCGAACAAGGCANCAAGGCGAGGAAGAGGAAACNNGCNCNNNACGGNNACCCNGCNCAACCGCCGGNAGNCNACGGACANCCGAAAACA
CCCANCCACCCACNNNACAAACAAAACGGGAGCACCCCAAGGANANGCACNCGGNCNAANGAAGCCNNNGCNCAACAACNCANGAAGNNGGGCAAANAAC
ACCCANAACNCCGAGGGAACCANNCNANAAGGGGGNANAGAAANGGGGCGAGAGCCCGGGNCAAGAACAANACAGAAGNCAANANCCCNAACCGGCGGCA
CACCAGGAAGAACAGCAGGGAACACANCCAGAAACCCACGGACCACCGAAACCGA

This is probably not a useful sequence.

Problems:
  • High predicted error rate
Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.990206
Expected error %
28.7303
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT66771.1| Score 122 E Value 6e-27 Identity 13.20% Align. Length 566bp (86.41%) Frame 3
putative polyprotein [Solanum demissum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT38745.1| Score 116 E Value 4e-25 Identity 12.50% Align. Length 584bp (89.16%) Frame 3
putative polyprotein, 3'-partial [Solanum demissum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0174O05
Clone
Clone name
hba-174o5
LE_HBa0174O05
P174O05
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found