Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

Clone Read LE_HBa0174O13_SP6_203053

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0174O13_SP6_203053
Primer
SP6
ID from Seq. Facility
LE_HBa_174_O13-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
500 trimmed for vector and quality, 811 raw
Sequence
>LE_HBa0174O13_SP6_203053 (raw untrimmed)
GTTTGATGGCAAGGCTGTGAAGTATTACTTTATAGGATATGGTTCTGATTTGTTTAGTTAAAGGTTTTGCCATTTCAAGAACAGAAAGATCCTGAGACAT
TGTGATGTGACATTTAATGAGTCTTTCCTGTACAAGGACAGAGAGTAGAAGGTTCTACAGATTACAAAGCAAGTGGGAGTTGAGGTTGAGTTGGAGAAGA
GTAACCCCAGAGATGTCGAAGCAGATACTCAACAAACTCCTACTGAAGAATCTGAAGTGGAGCAAGTTACACCTGACCAGGTGTTAAGGTGATCATCTAG
ATCCATCAGTGCACCAGATAGGTATTCACCTTCATTACACTATCTATTGTTGACTTATGAGGGGGAACCAAAGTCTTTTGATGAGTCCCTACAGGTGGAG
GATTCGATCAAGTGGGAGCAAGCCATGGATGATAAGATGAGGTCACTTGAGAAGAATGACACATGGGTGTTGACTGAGTTACCTGCAGGGAAACGAGCTT
TGGTGAACAAGTGGGTGTTCGAAATCCTGACCCTAACAAGATGGCAACAAAAGGTTTCAAGGCACGTAGACTTGTTAAAGGATATTCTTAAAAGAAAAGT
ATTGGATTATGCCTAAATATTCTCTCCTATTGTGAAGTTTACCTCCATTCAAAATCGGTTGAAGATTGTTGAATCGGAAAATTTGCATCTAGAGCAAAAT
GGATGTTAAAAACAACGTTTTACATTCACGTTTGGAACAAGAAATTTTTTTATTACATTTAACGGGAAGGAATTTGGTGGTCTCTAGGCAAGAGAATAAA
GGGGGGTGTCA
>LE_HBa0174O13_SP6_203053 (trimmed for quality and cloning vector)
GTGAAGTATTACTTTATAGGATATGGTTCTGATTTGTTTAGTTAAAGGTTTTGCCATTTCAAGAACAGAAAGATCCTGAGACATTGTGATGTGACATTTA
ATGAGTCTTTCCTGTACAAGGACAGAGAGTAGAAGGTTCTACAGATTACAAAGCAAGTGGGAGTTGAGGTTGAGTTGGAGAAGAGTAACCCCAGAGATGT
CGAAGCAGATACTCAACAAACTCCTACTGAAGAATCTGAAGTGGAGCAAGTTACACCTGACCAGGTGTTAAGGTGATCATCTAGATCCATCAGTGCACCA
GATAGGTATTCACCTTCATTACACTATCTATTGTTGACTTATGAGGGGGAACCAAAGTCTTTTGATGAGTCCCTACAGGTGGAGGATTCGATCAAGTGGG
AGCAAGCCATGGATGATAAGATGAGGTCACTTGAGAAGAATGACACATGGGTGTTGACTGAGTTACCTGCAGGGAAACGAGCTTTGGTGAACAAGTGGGT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.956629
Expected error %
0.360323
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
pir||T02206 Score 84 E Value 2e-15 Identity 13.00% Align. Length 485bp (97.00%) Frame 2
hypothetical protein - common tobacco retrotransposon Tto1 dbj|BAA11674.1| ORF(AA 1-1338) [Nicotiana tabacum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAV88069.1| Score 82 E Value 5e-15 Identity 11.70% Align. Length 485bp (97.00%) Frame 2
hypothetical retrotransposon [Ipomoea batatas]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0174O13
Clone
Clone name
hba-174o13
LE_HBa0174O13
P174O13
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found