Clone Read LE_HBa0176E17_T7_203237

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0176E17_T7_203237
Primer
T7
ID from Seq. Facility
LE_HBa_176_E17-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
113 trimmed for vector and quality, 935 raw
Sequence
>LE_HBa0176E17_T7_203237 (raw untrimmed)
TCTTAATCACCCCGGACCCGTGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTTTTATGGCAATCTCTAGTGAAAATGTCATTTAACTTATTATT
ATTATTATTATTATTATTATTATTCTATAAATTCAAAATCGGTAATGAAAGATAAAAGAGAATTTAATGTATCCTGTCTCGGGTGAGAGAATGTGGTCTT
CTAAATAAAGCCTCATATCATTAAGCCACGATCTGAGTTGGGGCATCGCGCGTTGAGCTGGCTATGCTAAAGTAAAGTGAGGATACACGAAGGCAATCCC
GCGAGGATAGAGGTGAGACTGTGGATGTCGTATTTTATCCATTGAAAGCCTGAGTCGCATTTATGCTTCTATGCTGTGGCTTGCATGATCTTTATGTTCG
GTTTCATCTTGTTCTTGTATTACTTAGACTCAATCCCAGAATTCATTAGATCTAGTCATATCCAAGGCCACTCTCAAGGCCTCGCCTTATGGGCGATCTA
TAGGTAATTATATACTCGCAACGGAGAATAGGTAGCGGTTCGGGCTGAGTGCTGTAGTGATGGTCGTTTTTCGTGTTTCTTTTTCTCTCCTTCTTGTCGT
TCACTGCATGCAGGCTCGTCTCCGCCGATCGCGGTTCTCGCGTAGAGTCGTTTGTGACTGGTCTATATGGACCGTTGTGTTAGCTCTTGTATTCCGCTTA
ATTATGTGCTATGCGCACGTGGTGTTAATATTTNTGGATCCGCACATCGTGCGAATGCCCTTACGGTGTCCTCTGCTCGAGCGTAGGGTGTTTACAATAG
CGTAATCGCTTCATCCCTATCACTATTCGGAGTCTCAAGGGAAGACTAGCCACCTATAGTCATAGTGTTTGGTCTCTTCGGCCGCATAAGTGCAGAGGTG
ATGGAGTTCACTGAAACATGCCCAGTGCGTTCATA
>LE_HBa0176E17_T7_203237 (trimmed for quality and cloning vector)
AGCTTTTTATGGCAATCTCTAGTGAAAATGTCATTTAACTTATTATTATTATTATTATTATTATTATTATTCTATAAATTCAAAATCGGTAATGAAAGAT
AAAAGAGAATTTA

This is probably not a useful sequence.

Problems:
  • Low complexity
  • Short cloning insert
Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.813608
Expected error %
1.17115
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0176E17
Clone
Clone name
hba-176e17
LE_HBa0176E17
P176E17
Clone type
BAC
Contamination
none
Estimated length
32,562
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found