Clone Read LE_HBa0176J15_T7_203355

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0176J15_T7_203355
Primer
T7
ID from Seq. Facility
LE_HBa_176_J15-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
372 trimmed for vector and quality, 919 raw
Sequence
>LE_HBa0176J15_T7_203355 (raw untrimmed)
CTCGGTCCCGCGGGGTCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTNGGAGTACTAGGAAGTCAGATACTCGGGAGAAATACCTTCGCAGTGTAATCC
ACTCACAACCCAACCATAGATGAGATCCGTGAAGACATGGCACAGATGAGAACTGATCTTGGGTTGGTATTAGAACATATCACTGGGGGTGCAGAAAAGA
TAAATACAGTTAACTAATTGTCTAAACCACCACCACCTAATGATGAATGCTATTATGCGGAGGATTCCTATGCAGTAAATGAGCAGAGGGGGGTTTCCAA
GCAAGGGCCTATGTCTCAAATCATGATAATTGGCGCCTAGGTCAATGTAACCAATGTCATATTTATGGTAACTATTATTGTGACGGTCATTATGTCAAAT
AAGGAAACTACAACCACTGCAACAACTCCCACAATGGTAACAACGGTAACAAATAATGATAAGAATGAGCCCTATATCTCTCCTCATAATCTTTACATTC
TTGCTTAGAATATCGGATTAAATATTTGTTCTATTTGTATTTATATTTCTTTTTATTTATTTATTATTTTTTATTTTTATTCTTTTACATTCATTTTTTT
TTTTATCATTTTTTTTTTGCTTTTTCCTACTTATTTATTTTTCTTTGCTTTCCCGGTCTCACTTTCATTCTTAATTTTGAAATATCATCCTCCATTCTTT
CTATCTTTCTTTTAGTCATTCTCCTGCTAATTTCATTCTTCATATATCTTTTTAAAGTATATTGGTGCTTGTAGCGAAGTTATCGATGAGTAAACGGTTG
TTCTTTTACTTATACTTCTCTCTTCTAATTCTTAATTTTTCCTTTTCCTCATTTATCTTTTTTTCCTATTATTCACACATTAACTTATACACTCCCTCTC
TTGCATCTTCAACTCTTTA
>LE_HBa0176J15_T7_203355 (trimmed for quality and cloning vector)
AGCTTNGGAGTACTAGGAAGTCAGATACTCGGGAGAAATACCTTCGCAGTGTAATCCACTCACAACCCAACCATAGATGAGATCCGTGAAGACATGGCAC
AGATGAGAACTGATCTTGGGTTGGTATTAGAACATATCACTGGGGGTGCAGAAAAGATAAATACAGTTAACTAATTGTCTAAACCACCACCACCTAATGA
TGAATGCTATTATGCGGAGGATTCCTATGCAGTAAATGAGCAGAGGGGGGTTTCCAAGCAAGGGCCTATGTCTCAAATCATGATAATTGGCGCCTAGGTC
AATGTAACCAATGTCATATTTATGGTAACTATTATTGTGACGGTCATTATGTCAAATAAGGAAACTACAACC

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.977125
Expected error %
2.47666
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT38730.1| Score 88 E Value 2e-23 Identity 62.90% Align. Length 289bp (77.69%) Frame 2
putative reverse transcriptase [Solanum demissum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0176J15
Clone
Clone name
hba-176j15
LE_HBa0176J15
P176J15
Clone type
BAC
Contamination
none
Estimated length
88,101
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found