Clone Read LE_HBa0176J18_T7_203358

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0176J18_T7_203358
Primer
T7
ID from Seq. Facility
LE_HBa_176_J18-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
406 trimmed for vector and quality, 901 raw
Sequence
>LE_HBa0176J18_T7_203358 (raw untrimmed)
CTCGGTACCCGGGGGACCTCTAGAGTCGACCTGCAGGCATGCAAGCTTAGCAGCTGCCTCTTCATCGAATCCGTTGTGGATGGTCATGGGTGCATCGACT
CTATGTACTTCCCATTCAGCACCTTTGGCTTGTGTGAAGGTTCTCAATGGTTTCTGCGAGAGCAACCAGGACTCTGTTGAGCACGAGGCACGTGTTTTAG
AAGATAAAGATTTACCAGGTCGTGAACAACTCCTTCAAACGTTGCAGGGGAGTTCGTTCATTGAGAAAGATGCACTATCAGCGGCTGCAGAAGCAGTGAA
AACTGCAATGTGTAATCTATTAATCAAGAAGCAGTACCCTTCTGAAAATCGAGAGTTTAGAAAGAGAGGGAGGAACGACAAGAGAGTAGATAAGAAAAAA
TGAGATCGGTGGACAAAGTTACATGGTATGTACGCTGGTGGGAGGTTATTAGATGTTTCTGATGCCGAGTAGATTTTGGTGTGGGCAAGTCTTTATGTAG
TGTGTTTCTCGTTCCCATCTTTATTTCGTGTCTTTGATTTAAGCTTTGTTTTAACATTTGCTTTTTTGATTTTATTTGTGATTTATGTACTGTATTTTTT
TCTGTTCTTAGGTGTACGTTATGTGTGATATGGGTTTCGGTTGTTCGCCTCCTTCTTCGGTTGCTTTTTGTTTCTTCCGCATTCTCTTTTTATATGGGTT
TGTTTGTGTGTGAGTATCGGTATAAGGTTCTTTTTCTCTTTTATTATTTTTCGTTTTTTTGACATGTTTCTTGTTTATTTTTCATTATATTTTGTTGATA
TTTGTGAACTTTTGTTTGTGGTGTACTCTAACATTTCTTTTATCGATCTTATTCCATGCTATTATTCAGTTAATATCTAATTAGTTAGTATTAGTGTCTC
A
>LE_HBa0176J18_T7_203358 (trimmed for quality and cloning vector)
AGCTTAGCAGCTGCCTCTTCATCGAATCCGTTGTGGATGGTCATGGGTGCATCGACTCTATGTACTTCCCATTCAGCACCTTTGGCTTGTGTGAAGGTTC
TCAATGGTTTCTGCGAGAGCAACCAGGACTCTGTTGAGCACGAGGCACGTGTTTTAGAAGATAAAGATTTACCAGGTCGTGAACAACTCCTTCAAACGTT
GCAGGGGAGTTCGTTCATTGAGAAAGATGCACTATCAGCGGCTGCAGAAGCAGTGAAAACTGCAATGTGTAATCTATTAATCAAGAAGCAGTACCCTTCT
GAAAATCGAGAGTTTAGAAAGAGAGGGAGGAACGACAAGAGAGTAGATAAGAAAAAATGAGATCGGTGGACAAAGTTACATGGTATGTACGCTGGTGGGA
GGTTAT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.973709
Expected error %
0.18379
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At1g03110.1 Score 82 E Value 7e-17 Identity 15.20% Align. Length 314bp (77.34%) Frame 2
68414.m00288 transducin family protein / WD-40 repeat family protein contains 4 WD-40 repeats (PF00400); similar to WD-repeat domain 4 protein (GI:9955698) [Mus musculus]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAL15226.1| Score 82 E Value 4e-15 Identity 15.20% Align. Length 314bp (77.34%) Frame 2
unknown protein [Arabidopsis thaliana] gb|AAK44043.1| unknown protein [Arabidopsis thaliana] ref|NP_563675.1| transducin family protein / WD-40 repeat family protein [Arabidopsis thaliana]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAD25797.1| Score 82 E Value 4e-15 Identity 15.20% Align. Length 314bp (77.34%) Frame 2
Contains 2 PF|00400 WD40, G-beta repeats. [Arabidopsis thaliana] pir||B86162 F10O3.6 protein - Arabidopsis thaliana
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0176J18
Clone
Clone name
hba-176j18
LE_HBa0176J18
P176J18
Clone type
BAC
Contamination
none
Estimated length
117,741
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found