Clone Read LE_HBa0176J20_T7_203360

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0176J20_T7_203360
Primer
T7
ID from Seq. Facility
LE_HBa_176_J20-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
243 trimmed for vector and quality, 907 raw
Sequence
>LE_HBa0176J20_T7_203360 (raw untrimmed)
CTTCGTTCCCGGGGGGACCTCTAGAGTCGACCTGCAGGCATGCAAGCTTTGCTTGCCAAGCGCTTGGGCAAGAAACGCATCATTGCTGAGACGGGGGCAG
GTCAGCATGGTGTTGCCACTGCTACTGTTTGTGCTCGTTTTGGTTTGGAATGCATTATCTATATGGGTGCGCAAGATATGGAGAGACAAGCACTAAACGT
CTTCAGAATGCGCCTGCTTGGCGCTGAGGTTTGTTTCCTACATTATGAGTTATGTGTTTGTTTTTATCTTGCTTTATGCAGAACATTTAATGTTTGCAAA
TTATTTACAGTCTCATTCTGCTGTTCTATATGTCTCTTCTACTCTATGTTGCTGTTTTACTTTGAGTGCTGTACTCCTACATACTCACTTCTTTTCTCTA
TTTTTCTGTACTTTCTCATATCTTGACTCATTTTATCGTTTTTCATTTACTTTCTATTTTTCTCTCTCTTCACCCTCTTTATTTATTTTTTCTCACAACT
TTGCTGTATATTAATATTGTTTATTTCCCCTCATCTCCGTCCGTTTTTTATGTCTTATTTCGTCTAAAATTTTTTTTATTCCTATTACATTTTCCTCCTT
CTCTGTCTATTAAATCTTTGGTACTTTCCATTGCTTGCTCTTCCTTCTTTTCTTTATACTCCATCTCTTTTCTCTTTCTTTTTTTTTTTTTTTTTACTTC
TGCTTTTTTTCCCTTTATTTTTATTTATTATTTTCTATTTATTTTTCACATTTATAAATTTGTACTTATCGAATGAGTTCTTACTGTATTGTCTCTTACC
TTCAACTTATAATTATTATTAAATTAAGACTTAACACACATATATTCTTTCCAATTTTTACCTTATTTAGACTTTCCTTATTTTCTCTTTTATATTTTAA
TTATTGC
>LE_HBa0176J20_T7_203360 (trimmed for quality and cloning vector)
AGCTTTGCTTGCCAAGCGCTTGGGCAAGAAACGCATCATTGCTGAGACGGGGGCAGGTCAGCATGGTGTTGCCACTGCTACTGTTTGTGCTCGTTTTGGT
TTGGAATGCATTATCTATATGGGTGCGCAAGATATGGAGAGACAAGCACTAAACGTCTTCAGAATGCGCCTGCTTGGCGCTGAGGTTTGTTTCCTACATT
ATGAGTTATGTGTTTGTTTTTATCTTGCTTTATGCAGAACATT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.945439
Expected error %
0.873437
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At5g54810.1 Score 124 E Value 8e-30 Identity 31.80% Align. Length 197bp (81.07%) Frame 3
68418.m06827 tryptophan synthase, beta subunit 1 (TSB1) identical to SP|P14671
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At4g27070.1 Score 123 E Value 2e-29 Identity 31.30% Align. Length 197bp (81.07%) Frame 3
68417.m03892 tryptophan synthase, beta subunit 2 (TSB2) identical to SP|25269
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAM64932.1| Score 124 E Value 6e-28 Identity 31.80% Align. Length 197bp (81.07%) Frame 3
tryptophan synthase beta chain 1 precursor [Arabidopsis thaliana] gb|AAM91450.1| AT5g54810/MBG8_7 [Arabidopsis thaliana] dbj|BAB08760.1| tryptophan synthase beta chain 1 precursor [Arabidopsis thaliana] ref|NP_200292.1| tryptophan synthase, beta subunit 1 (TSB1) [Arabidopsis thaliana] gb|AAK56253.1| AT5g54810/MBG8_7 [Arabidopsis thaliana] pir||A31393 tryptophan synthase (EC 4.2.1.20) beta-1 chain precursor - Arabidopsis thaliana sp|P14671|TRPB1_ARATH Tryptophan synthase beta chain 1, chloroplast precursor gb|AAA32878.1| tryptophan synthase beta subunit
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
emb|CAB79562.1| Score 123 E Value 1e-27 Identity 31.30% Align. Length 197bp (81.07%) Frame 3
tryptophan synthase beta-subunit (TSB2) [Arabidopsis thaliana] emb|CAB38837.1| tryptophan synthase beta-subunit (TSB2) [Arabidopsis thaliana] gb|AAM60917.1| tryptophan synthase beta-subunit TSB2 [Arabidopsis thaliana] gb|AAO24576.1| At4g27070 [Arabidopsis thaliana] ref|NP_194437.1| tryptophan synthase, beta subunit 2 (TSB2) [Arabidopsis thaliana] sp|P25269|TRBP2_ARATH Tryptophan synthase beta chain 2, chloroplast precursor pir||T06037 tryptophan synthase (EC 4.2.1.20) beta chain T24A18.20 - Arabidopsis thaliana gb|AAA32879.1| tryptophan synthase beta-subunit
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0176J20
Clone
Clone name
hba-176j20
LE_HBa0176J20
P176J20
Clone type
BAC
Contamination
none
Estimated length
130,292
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found