Clone Read LE_HBa0178I15_T7_203715

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0178I15_T7_203715
Primer
T7
ID from Seq. Facility
LE_HBa_178_I15-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
709 trimmed for vector and quality, 847 raw
Sequence
>LE_HBa0178I15_T7_203715 (raw untrimmed)
CTCGGTTCCCCGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTTAACCATCAACCCCAACAAGATCTCCTAAAATTGAAAACAGATCTTAACAC
CACAGAGAATTTCATAATATTGCGATACCTGCCAATCAATCCAGCAAGGGGTCCACCTGTGATCCTAAAATTGAAATACATACCAGTAAACAACCGTGGA
GACACCAAAAGGAACATAATAACAAAGTAGTTTTCCTAGAAAAATAGCTTCTAAAATATCACATACCCACTAGAAATTCCACCACCGGCAGAAATACCAC
CCCCGCTCTTGCGCTCGACAACATTCATAACTAAGTCTACCTTACCAGTGTCTGCAATATTGCAATATTACATCAGAAAGTTACTCTACAGAAAGAACAA
TAGTAGAACATACAGTAGACAGCCAAAAGGGTAAGGAGGAGCCTGCGCCAACCAAATTTTTGTTGTGCATACAGTCTCTTTTATATGATCGATATTTAAA
TATTTTATATAAAGCTTCTGCCTAACCACTATTCACCAAGCACAACCAAAGAAACCCACAAGCAAACAGCTTTTAGTTATCACTAAGTCTTTTAGGTGTA
CATTTCACAAAGCAAACATAGTTTGCCATAACTTCTAATGTCTTCTCCAAGAACAAACCACTTTTTTCACAAATCAGTTTATTTTTTGTATTCCATTCTT
GGATGTAGTACATGAAATATTTTCCCTCTTATTATTCCAATTTAGATTTAACTTAAACCTTCAGTTAAAAAGTTACTTATTTTAAATTAAGACGTTAGTT
TTTTACTCAAATTCCAAAAAACTTTAAACACCAAACCAATAACCCCG
>LE_HBa0178I15_T7_203715 (trimmed for quality and cloning vector)
AGCTTTAACCATCAACCCCAACAAGATCTCCTAAAATTGAAAACAGATCTTAACACCACAGAGAATTTCATAATATTGCGATACCTGCCAATCAATCCAG
CAAGGGGTCCACCTGTGATCCTAAAATTGAAATACATACCAGTAAACAACCGTGGAGACACCAAAAGGAACATAATAACAAAGTAGTTTTCCTAGAAAAA
TAGCTTCTAAAATATCACATACCCACTAGAAATTCCACCACCGGCAGAAATACCACCCCCGCTCTTGCGCTCGACAACATTCATAACTAAGTCTACCTTA
CCAGTGTCTGCAATATTGCAATATTACATCAGAAAGTTACTCTACAGAAAGAACAATAGTAGAACATACAGTAGACAGCCAAAAGGGTAAGGAGGAGCCT
GCGCCAACCAAATTTTTGTTGTGCATACAGTCTCTTTTATATGATCGATATTTAAATATTTTATATAAAGCTTCTGCCTAACCACTATTCACCAAGCACA
ACCAAAGAAACCCACAAGCAAACAGCTTTTAGTTATCACTAAGTCTTTTAGGTGTACATTTCACAAAGCAAACATAGTTTGCCATAACTTCTAATGTCTT
CTCCAAGAACAAACCACTTTTTTCACAAATCAGTTTATTTTTTGTATTCCATTCTTGGATGTAGTACATGAAATATTTTCCCTCTTATTATTCCAATTTA
GATTTAACT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.943556
Expected error %
0.648342
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0178I15
Clone
Clone name
hba-178i15
LE_HBa0178I15
P178I15
Clone type
BAC
Contamination
none
Estimated length
88,000
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found