Clone Read LE_HBa0179A02_T7_203894

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0179A02_T7_203894
Primer
T7
ID from Seq. Facility
LE_HBa_179_A02-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
18 trimmed for vector and quality, 1009 raw
Sequence
>LE_HBa0179A02_T7_203894 (raw untrimmed)
ATACGAGGAAATGGATCATCTAACTGTCCACCTCTTTTTTTTCGGCGCCAGACGACGATAGCACGCAAGCACCAGAAGNAGACCACACCGAAGGACCTTT
TTTGAGGGGAACCACACACGCAGCACTATAGGAGGGTGGGATAGAGTGCCTTGCTACCTGAGACGTACGAGCCCATTATCTGTTACCAGTGTGCATAAAC
TATATTTTACAAGAATCATGGACTTAGCTACACCAAACACATACCTACATGAAACTTAGAAGGCACAAGAGCGCATTATAAACAAGCAATTATCCGTATC
TTAGACAGCACTCATATTAATGCCTATGACGCGACAAATCGTCTCTACTGTAAACCATTCTATATCACCAACGACGTCCTTCTTAGTAATGAAGTCACGG
CCTCCAACAGGAAGCGTCACTAGCTCGAGGGACAATTGCACGGTGTGCATTCACGAACGATCCTCAACGTGATTAATGTACATAATCCTTACTGACTTTC
TCCAAACCAACTCAAAACAGCTTTCACGCTACTTGGCTAAACACTCTTCGTACCCTGATTTAATCCTACATGTGAATTACTATCTATATGCATTATGTAA
TTACAAATCCTTCCAATCTTTACTCATTGATATTCCAACTTCCAGTGTCTAACTTACATTTCATTTTTTCCCCCCCCCACT
TTTTTTTTTTTTTTTTTTT
TTACCCCCCAAGAAAAGANTAAAGAAGTGGAATAAAGATGATTGATATAAATAATATTAATGATAAGTATTTTTATAAAGATAATTAATTAATTGAATAN
TAATTAATAGGAGTAAAGTTTATATTATGGAGGATTTTTAGTATTGTGTATGAGAAAGTAAGGTGGAATATATAATGATATATGAGTTATAGGTTTATGA
GAATTTTTGATAGTATTTGAGGTGTGGATGTATTGAGGGTGGTNTGATANAGATGTGTATATTGAGAATGTATATTAAGAAAGATTATATGTATGAGAGG
TGTGAAATG
>LE_HBa0179A02_T7_203894 (trimmed for quality and cloning vector)
TTTTTTTTTTTTTTTTTT

This is probably not a useful sequence.

Problems:
  • Low complexity
  • Short cloning insert
Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
not recorded
Expected error %
0.594414
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0179A02
Clone
Clone name
hba-179a2
LE_HBa0179A02
P179A02
Clone type
BAC
Contamination
none
Estimated length
156,649
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found