Clone Read LE_HBa0179E24_T7_204012

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0179E24_T7_204012
Primer
T7
ID from Seq. Facility
LE_HBa_179_E24-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
517 trimmed for vector and quality, 786 raw
Genbank Accession
Sequence
>LE_HBa0179E24_T7_204012 (raw untrimmed)
TCTGGTACCCGGGGGATCCTCTAAAGTCGACCTGCAGGCATGCAAGCTTATCAACTATTTACCATCAACCCCTTTATACGAGCTCTACATAGGTTAAAAT
GGAGTGATATTGTACATTTGATTACAAATTTGCTTATATCTTTCAAAGATTCAAAATCATTACCGTAGAAATGGAGCCAATTGGTCGCTACGGGCAAACT
GACCAATTTTCAAGATCAAACGAGTCTCAGGGCAGGTAAACACCATTTTGCTGATTTTCATGTACTATAATTCATAGATTTTTGGTGATCCTAAATTTTG
GATTTGTTTTTTGCCAAAATTTTTCATAGACGTCTGTTAATACCTTAGTAATGGAGCCATTTGCTCCCGGGCAAACATGTCCGTTTTAAAGATCAAATGA
TCTCCAGTGTAGGTAAACCCCCATTTTATGATTTTCGTGTACTATAGTCCAAGAGATTTTAGATATCCAGAATTCTGAAATTTTTTTTGTTAATTTTTTT
TTTATATATCCATTAAGACCTTAACAATCTTTTTTTTCACCCCCTTTTTTTTTTTTTTTTTTTCACCGCCAAGGTCAAATTGGCCCTTGAATACGGTAAA
CCCCATATGTGTTTGATTTTTGTGGGAGGTAAAATTAAAATTCCTTGATTTTTATCTCTAAAAGTATTATTATGATCTGCGGTGAATGCATGAGTAATGT
GAGTACCTTCGTAGAACGTTGGATTAATACGATTTGTTCTGGTAGTAGAGTTATGTATTCGCTTATCTTTTCATTCGCTTTTTTTT
>LE_HBa0179E24_T7_204012 (trimmed for quality and cloning vector)
AGCTTATCAACTATTTACCATCAACCCCTTTATACGAGCTCTACATAGGTTAAAATGGAGTGATATTGTACATTTGATTACAAATTTGCTTATATCTTTC
AAAGATTCAAAATCATTACCGTAGAAATGGAGCCAATTGGTCGCTACGGGCAAACTGACCAATTTTCAAGATCAAACGAGTCTCAGGGCAGGTAAACACC
ATTTTGCTGATTTTCATGTACTATAATTCATAGATTTTTGGTGATCCTAAATTTTGGATTTGTTTTTTGCCAAAATTTTTCATAGACGTCTGTTAATACC
TTAGTAATGGAGCCATTTGCTCCCGGGCAAACATGTCCGTTTTAAAGATCAAATGATCTCCAGTGTAGGTAAACCCCCATTTTATGATTTTCGTGTACTA
TAGTCCAAGAGATTTTAGATATCCAGAATTCTGAAATTTTTTTTGTTAATTTTTTTTTTATATATCCATTAAGACCTTAACAATCTTTTTTTTCACCCCC
TTTTTTTTTTTTTTTTT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.926264
Expected error %
2.12352
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0179E24
Clone
Clone name
hba-179e24
LE_HBa0179E24
C05HBa0179E24
P179E24
Clone type
BAC
Contamination
none
Estimated length
82,845
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found