Clone Read LE_HBa0179M04_T7_204184

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0179M04_T7_204184
Primer
T7
ID from Seq. Facility
LE_HBa_179_M04-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
715 trimmed for vector and quality, 772 raw
Sequence
>LE_HBa0179M04_T7_204184 (raw untrimmed)
CCCGGACCCCGGGGTTCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTCAACTAAACATACATGGTTGATCTTTTGTTGTTTCATTAACAGTGCAATTCA
ACATGTACATGGTTGATCACTTGTTGTTTCATTAACAGTGCAATTCAACATGTTACAAAGTCCAGCGTGGATGGCTGTATGACCCTAGAGTGTTATGAAC
TGTTTCTTCGAGAAGGATGATACCACCACCTATCAGGCCCGACGATTGGTCCACAGAGTTGTATCCCTGTTCATCTGGTCTAAAAATAATATCAAAGGCT
TGTTTGGTTAATATCAGTAGCTCTGTTTCTTCTATTTATATTTATATATGCCAATTGTATTTAATTTGAATTCTATTTATATTTATATATGGCAATTGTA
TTTAATTTGAAAGAGAAATTTTCCTAATACGCAGGCAAATACACCAAAATATATATATATGCCAATACACCAAAAACAATTCCGTTGCCGGGACTTGAAC
CCGGGTCTCTCGGGTGAGAGCCGAGTATCCTAACCCACTACACTATTTCTTATTTTTTTTCCGCCATTTGGTCATTATTCTTTATAAATCGTAGCAATCT
ACTATTGATTTTATCTCAAGCAATGCGTTGGGTAACTCCCGATATAATGTAAAAGCAAGATGTGTCATTTTGAAAAGTAAAAAGAAAAGAACATTAGTCC
AAGTTTCTTTTACAATTTGACTCCATTCAAGTAAAAAACACATGATATTTTGTCTTTCCCCCCTCCCTCAAG
>LE_HBa0179M04_T7_204184 (trimmed for quality and cloning vector)
AGCTTCAACTAAACATACATGGTTGATCTTTTGTTGTTTCATTAACAGTGCAATTCAACATGTACATGGTTGATCACTTGTTGTTTCATTAACAGTGCAA
TTCAACATGTTACAAAGTCCAGCGTGGATGGCTGTATGACCCTAGAGTGTTATGAACTGTTTCTTCGAGAAGGATGATACCACCACCTATCAGGCCCGAC
GATTGGTCCACAGAGTTGTATCCCTGTTCATCTGGTCTAAAAATAATATCAAAGGCTTGTTTGGTTAATATCAGTAGCTCTGTTTCTTCTATTTATATTT
ATATATGCCAATTGTATTTAATTTGAATTCTATTTATATTTATATATGGCAATTGTATTTAATTTGAAAGAGAAATTTTCCTAATACGCAGGCAAATACA
CCAAAATATATATATATGCCAATACACCAAAAACAATTCCGTTGCCGGGACTTGAACCCGGGTCTCTCGGGTGAGAGCCGAGTATCCTAACCCACTACAC
TATTTCTTATTTTTTTTCCGCCATTTGGTCATTATTCTTTATAAATCGTAGCAATCTACTATTGATTTTATCTCAAGCAATGCGTTGGGTAACTCCCGAT
ATAATGTAAAAGCAAGATGTGTCATTTTGAAAAGTAAAAAGAAAAGAACATTAGTCCAAGTTTCTTTTACAATTTGACTCCATTCAAGTAAAAAACACAT
GATATTTTGTCTTTC

This is probably not a useful sequence.

Problems:
  • Probable foreign DNA contamination
Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.954943
Expected error %
1.24045
Sequence Annotations 
Automatic Annotations
Arabidopsis thaliana Mitochondria (screening/organelle/ATH1_mitochondria)NCBI BLAST
mitochondria Score 62 E Value 6e-11 Identity 90.20% Align. Length 50bp (6.99%) Frame 2
No sequence description found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0179M04
Clone
Clone name
hba-179m4
LE_HBa0179M04
P179M04
Clone type
BAC
Contamination
none
Estimated length
100,932
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found