Clone Read LE_HBa0179P09_T7_204261

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0179P09_T7_204261
Primer
T7
ID from Seq. Facility
LE_HBa_179_P09-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
639 trimmed for vector and quality, 801 raw
Genbank Accession
Sequence
>LE_HBa0179P09_T7_204261 (raw untrimmed)
TAGGTCGGTCCCGCGGGATCCTCTAGAGTCGACCTGCGGGCATGCAAGCTTCAGTGGGAGAGCAAAGATGATGCATGGATGAAGAAAAGCTTTCACTAAC
TATCAACAAAATACAGCAGACAAGTGAATAAAACAAAAAGAGAATTCCCATCTTCTTTTTGCTTATTTTCAGCAAATAATAAGATGATGTTGCTAAATCA
ATCATCATAATATATATATATATATATATATACATGAAAAGGTAGTGTCAAGTGTGTACACATAACAACCAACTTTTCTGTTTTATAGTTGTTCACAACA
ACTATATCACACAAACAATCCATTTGAACTTCAGACATAAAATATATTAAAAAAAAGATATTGAGAGCTATTTTCTTACAAAGACTCTTAATTTAATTTA
TTTTTAGTGTTTGAATTTTGCGATTTAATTTTTAGATGTTTTAGTAGATAGAGCTTAAAATGAATTATATATTTTCTATTATTTACAATTTATTAAAATG
AAAAAAACTAATTTATTTCTAAAAATTCATATTATGATGTTAATACAAATAGTTTAACTATATGTATTTAGGAAATAAATTATTGCTTTTCGTCAAACGG
TAAAATTTTTGTTGAAATAATCATTTTTGTTCAATCTTTTTTTAAAAAATATTTCTTCCTTTCTTGTCCTTGTTATATATATATATTCTACATATATAGG
GATCTATTTTTTTACGCACCACTCTACTCGGTGATAAATAGTATTAGTACAGTATTCGTCAAATTTATAGGATATATTTTCTATTTTTTAGGTTCAAAGC
T
>LE_HBa0179P09_T7_204261 (trimmed for quality and cloning vector)
AGCTTCAGTGGGAGAGCAAAGATGATGCATGGATGAAGAAAAGCTTTCACTAACTATCAACAAAATACAGCAGACAAGTGAATAAAACAAAAAGAGAATT
CCCATCTTCTTTTTGCTTATTTTCAGCAAATAATAAGATGATGTTGCTAAATCAATCATCATAATATATATATATATATATATATACATGAAAAGGTAGT
GTCAAGTGTGTACACATAACAACCAACTTTTCTGTTTTATAGTTGTTCACAACAACTATATCACACAAACAATCCATTTGAACTTCAGACATAAAATATA
TTAAAAAAAAGATATTGAGAGCTATTTTCTTACAAAGACTCTTAATTTAATTTATTTTTAGTGTTTGAATTTTGCGATTTAATTTTTAGATGTTTTAGTA
GATAGAGCTTAAAATGAATTATATATTTTCTATTATTTACAATTTATTAAAATGAAAAAAACTAATTTATTTCTAAAAATTCATATTATGATGTTAATAC
AAATAGTTTAACTATATGTATTTAGGAAATAAATTATTGCTTTTCGTCAAACGGTAAAATTTTTGTTGAAATAATCATTTTTGTTCAATCTTTTTTTAAA
AAATATTTCTTCCTTTCTTGTCCTTGTTATATATATATA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.883848
Expected error %
0.705201
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0179P09
Clone
Clone name
hba-179p9
LE_HBa0179P09
C12HBa0179P09
P179P09
Clone type
BAC
Contamination
none
Estimated length
83,497
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found