Clone Read LE_HBa0180O10_T7_204622

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0180O10_T7_204622
Primer
T7
ID from Seq. Facility
LE_HBa_180_O10-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
653 trimmed for vector and quality, 797 raw
Genbank Accession
Sequence
>LE_HBa0180O10_T7_204622 (raw untrimmed)
CTCGGAAACCCAAGGGAACCTCTAGAGTCGACCTGCAGGCATGCAAGCTTTTAGAATGGATTCAATGGTGCCTTTTTCTCAAGGTGTCCTACTTGAGCAT
TGACAGTAGTATGCTTTGTGTCTGAACTCAAAATTTTCAGTCTGGTATAGAAATACTCGGGTGGTTTGCTTTAAATTTTTGAGCGACCATCCAATGCCAA
TGGTTTGTGCAAAGATTAAACCTCACATCGGAAGTTTCAGTGTCTCTCTGTGAGTTCTCCTTCAACACTAGCAATAACTGGGTTGAGCATCCCGCTGGAG
GAAATTCAATAAAGTTCTTGCTTTCCTTGAAACATAGATCACAACCAGAGATGCCAAAAGCAGTAAATCTGCAGAAACTCCAGTGATAACTGCGTTATAT
TGTCAAATTTCTGGGACTTCATTCTCCGATTCTATTTCAATGCCCAAACTGCAGGTTTCAAGTTCTGCGTCACGATCTTCCAACCTCCAGTTATTTCTTC
TTGTCCTATTAATTGTGTCTTTGATAATTTGTCTTCTGTGTTGATTTCCTTTGAGGTTTTCTCGACCTGCTCAACCTTGTAATCAGCTTCTGCTTGCTCA
AATTTGTAGCTTGTTAGAGTTCACAGCCTCATTTGTTTGCACAAGTATGTGAAAGCTCATCAAGCACAATGCTTTCAAGGTTTGATGGCTCCTGTGTTCT
CTTGACTATTATCCTTTCATTTTAAAACTCTTTGTCCTCTTCAAACCTGATCATTCTGGGTGTCAGGACCCTTCTAGTCCTTTTTTATCCTACTTAG
>LE_HBa0180O10_T7_204622 (trimmed for quality and cloning vector)
AGCTTTTAGAATGGATTCAATGGTGCCTTTTTCTCAAGGTGTCCTACTTGAGCATTGACAGTAGTATGCTTTGTGTCTGAACTCAAAATTTTCAGTCTGG
TATAGAAATACTCGGGTGGTTTGCTTTAAATTTTTGAGCGACCATCCAATGCCAATGGTTTGTGCAAAGATTAAACCTCACATCGGAAGTTTCAGTGTCT
CTCTGTGAGTTCTCCTTCAACACTAGCAATAACTGGGTTGAGCATCCCGCTGGAGGAAATTCAATAAAGTTCTTGCTTTCCTTGAAACATAGATCACAAC
CAGAGATGCCAAAAGCAGTAAATCTGCAGAAACTCCAGTGATAACTGCGTTATATTGTCAAATTTCTGGGACTTCATTCTCCGATTCTATTTCAATGCCC
AAACTGCAGGTTTCAAGTTCTGCGTCACGATCTTCCAACCTCCAGTTATTTCTTCTTGTCCTATTAATTGTGTCTTTGATAATTTGTCTTCTGTGTTGAT
TTCCTTTGAGGTTTTCTCGACCTGCTCAACCTTGTAATCAGCTTCTGCTTGCTCAAATTTGTAGCTTGTTAGAGTTCACAGCCTCATTTGTTTGCACAAG
TATGTGAAAGCTCATCAAGCACAATGCTTTCAAGGTTTGATGGCTCCTGTGTT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.950415
Expected error %
0.974575
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0180O10
Clone
Clone name
hba-180o10
LE_HBa0180O10
C12HBa0180O10
P180O10
Clone type
BAC
Contamination
none
Estimated length
80,643
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found