Clone Read LE_HBa0080I05_SP6_20744

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0080I05_SP6_20744
Primer
SP6
ID from Seq. Facility
LE_HBa_080_I05-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
627 trimmed for vector and quality, 811 raw
Genbank Accession
Sequence
>LE_HBa0080I05_SP6_20744 (raw untrimmed)
AATTTGGGACTCTNCGACGAATTAACGCATCTTCCCTTTAAAACGTAGCCTCATTGTTCATATAATTGAGTTTCGCCCTACTGAAAAGGAGAAGGACCCT
CCTCTGTTATCAATAGATGAACCAACCTCCAGTGCTCTCATAAAATTTACCTAATAAATGACTATATCAAAGGAAAACTTATAAAATAAATGTCAAATGA
AAGATGAGAGCCCTAAAGCAAAAAACTCTCTAAAAACATGATGAAAACCAATCTCAATAATCTCTCCGCCCCATATTAGTTGTTGATTTCCTTTTCACAC
GAAAATAAGAAATCATTAAATGAGAAGATAATTTTTTATATTCACTCTTATAAAGCATCTTCATTTTTTTTATAAACAAATGCGAATACTTTGAAAATGA
ATAAGTTGCAAGGATAATATAAGAAAAATATAAATTAATGTTTTATTGATTTAGTGAAGTGAGCAACTAATATGTGACAACTACTTTTAGTACAATGACG
AATTAATATAGGACAAATGGAGTAGAAAAAAACATAGTTAAAATAAAAACTAGTACATAGATATCTAATAAAGATGGTAAGAACAAAAACAGTTGAAAAT
AATTGTGTTTAAAGGTCTTCACAATATTTGTCCCTGAAACCTAAACTAGTACCTTAATAAGAAGTTTGTACCTATGCCCGAAATCTCAGAGACACACTTC
TACTATAAATAAGGTCCTATTACCGCCCATGAACTTATTTTACAAAGAATTTCCAACCCCTTTCCGTCCTACATGTCTCTATTCTTATGGGCCAATGGCG
GGTTGACCTTT
>LE_HBa0080I05_SP6_20744 (trimmed for quality and cloning vector)
GCCTCATTGTTCATATAATTGAGTTTCGCCCTACTGAAAAGGAGAAGGACCCTCCTCTGTTATCAATAGATGAACCAACCTCCAGTGCTCTCATAAAATT
TACCTAATAAATGACTATATCAAAGGAAAACTTATAAAATAAATGTCAAATGAAAGATGAGAGCCCTAAAGCAAAAAACTCTCTAAAAACATGATGAAAA
CCAATCTCAATAATCTCTCCGCCCCATATTAGTTGTTGATTTCCTTTTCACACGAAAATAAGAAATCATTAAATGAGAAGATAATTTTTTATATTCACTC
TTATAAAGCATCTTCATTTTTTTTATAAACAAATGCGAATACTTTGAAAATGAATAAGTTGCAAGGATAATATAAGAAAAATATAAATTAATGTTTTATT
GATTTAGTGAAGTGAGCAACTAATATGTGACAACTACTTTTAGTACAATGACGAATTAATATAGGACAAATGGAGTAGAAAAAAACATAGTTAAAATAAA
AACTAGTACATAGATATCTAATAAAGATGGTAAGAACAAAAACAGTTGAAAATAATTGTGTTTAAAGGTCTTCACAATATTTGTCCCTGAAACCTAAACT
AGTACCTTAATAAGAAGTTTGTACCTA

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.914473
Expected error %
0.0971099
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0080I05
Clone
Clone name
hba-80i5
LE_HBa0080I05
P080I05
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found