Clone Read LE_HBa0080K11_SP6_20852

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0080K11_SP6_20852
Primer
SP6
ID from Seq. Facility
LE_HBa_080_K11-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
662 trimmed for vector and quality, 813 raw
Genbank Accession
Sequence
>LE_HBa0080K11_SP6_20852 (raw untrimmed)
TGGGATAAGGGGGCCGGGTAAACTTNCAATCTTTTTAGTCCTTAACTTGTTCACGAACGAAGTGAAAGTCAACGCTGTCATGTTTCATCCTACTACGAAA
TACCGGATTGGAACAAATGTAAGTGGTGCTGATGTTACCATAGAAATCCCGTGGAACTCCATTAAGTGAAAGCCGATGTTCTTGAAGAATATTTTTGATC
AAGTTAAGGTTTACAACATCAGTTGCCACATCTCTATACTCAGCTTCTGTAGAGGACAAAGATACAGAGTGTTATTTCAGAGAGGCCGAGGAAATTGGTG
TATTGCCCAAGAAAATGATATGGCCAGAAGTAGAAGTGTGATCATTTGGATCACCAGCCATATTTGAATAAACAACCAAACGAGAATATGGATCTTTGAC
AATCTGTTTGCCATATTGGTAGGTGTGACGAAGATAACAGAGTAATTGCTTGACTTCTTTCCTGTGAGAGTGGTATGGATTGTGCATAAATTGAGACAGT
TTGCTAACAGTGAAGGCAATATCAAGATGCGTAAAGGATTAGTAGTGCAACTTTCCAATTACCCGCCTATAAAGAGTACCATTAACCAGAGGATCATTCA
CCGAGGTTGTCAAAATGGTAATTGAGGTCATAGGTGTAGGAGCTCCTTTACTATGTAGCATGCCAGCATCATCTAAAGTATCCATAATATACTTGTGCTG
GAACAAAAAAAGACCAGCGATTAGAAGAGATAACCTCCAAACCCAAAAAAAAATAAAGTTGTTCCATGTCGTTCAAGAAGAAATGAGTGGAAAGACCATC
ATTATATGACGTA
>LE_HBa0080K11_SP6_20852 (trimmed for quality and cloning vector)
CTTAACTTGTTCACGAACGAAGTGAAAGTCAACGCTGTCATGTTTCATCCTACTACGAAATACCGGATTGGAACAAATGTAAGTGGTGCTGATGTTACCA
TAGAAATCCCGTGGAACTCCATTAAGTGAAAGCCGATGTTCTTGAAGAATATTTTTGATCAAGTTAAGGTTTACAACATCAGTTGCCACATCTCTATACT
CAGCTTCTGTAGAGGACAAAGATACAGAGTGTTATTTCAGAGAGGCCGAGGAAATTGGTGTATTGCCCAAGAAAATGATATGGCCAGAAGTAGAAGTGTG
ATCATTTGGATCACCAGCCATATTTGAATAAACAACCAAACGAGAATATGGATCTTTGACAATCTGTTTGCCATATTGGTAGGTGTGACGAAGATAACAG
AGTAATTGCTTGACTTCTTTCCTGTGAGAGTGGTATGGATTGTGCATAAATTGAGACAGTTTGCTAACAGTGAAGGCAATATCAAGATGCGTAAAGGATT
AGTAGTGCAACTTTCCAATTACCCGCCTATAAAGAGTACCATTAACCAGAGGATCATTCACCGAGGTTGTCAAAATGGTAATTGAGGTCATAGGTGTAGG
AGCTCCTTTACTATGTAGCATGCCAGCATCATCTAAAGTATCCATAATATACTTGTGCTGGA

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.967634
Expected error %
0.202089
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At4g23160.1 Score 119 E Value 1e-27 Identity 11.80% Align. Length 653bp (98.64%) Frame 2
68417.m03342 protein kinase family protein contains Pfam domain PF00069: Protein kinase domain
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
dbj|BAA78423.1| Score 164 E Value 1e-39 Identity 13.80% Align. Length 659bp (99.55%) Frame 2
polyprotein [Arabidopsis thaliana]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAK62793.1| Score 164 E Value 1e-39 Identity 13.80% Align. Length 659bp (99.55%) Frame 2
polyprotein, putative [Arabidopsis thaliana]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0080K11
Clone
Clone name
hba-80k11
LE_HBa0080K11
P080K11
Clone type
BAC
Contamination
none
Estimated length
93,499
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found