Clone Read LE_HBa0080K11_T7_20853

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0080K11_T7_20853
Primer
T7
ID from Seq. Facility
LE_HBa_080_K11-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
746 trimmed for vector and quality, 849 raw
Genbank Accession
Sequence
>LE_HBa0080K11_T7_20853 (raw untrimmed)
CTCTGGTCCCGAGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTATGCTTGTAGTAATTTTTCGCCTCTTTTCCAAGACTATATATTCTTATCTT
CTTTTTTTCATCCGCAGCTTCGTAATACGATTGATCAGATTGAGATACCTTTTTTTCCGTAAGATCTCTTCATACCCTTCCTGTATTAAGTAGAGTTAAA
GAGAGGACATTAAAGATTAGGAAAAAAAATATATTGGTCAACTATGTAAGTTTCTAAAGAATAGGAAACCACATGATTTACATTTGTAAGAGGGGCATGT
CTAACCCTAGACAACCGGATGCAAAAGAACTCACACTGGTGCTATGAAGCTTGGAACTTCTTCCGTACAACTTCTAGATTGAAAAGGGTCATGCCTCAGA
CAGTAAGGCAAGCCCATGAAGTTTATATATTTGGAGAGTTGATAAAATCATCAGAAAGGTTTAGGAAATGGTCCCAAAAATCATCTTTTGGTATTCATGG
ACAAAAGCAACACCAGATGATTTGCTAGCACAAAAACTCTAACCTCTTATCTGAAGTCTAACTATTTAGCTAATTTGTTTAGCTCATATGCTTTACCCTT
GTAACTAATGAAGATACTTTTGTGGATTTTATATGCTCATTATCACCGCTAAAATTTTTTTTTGTAATAAATAAAGCAAAGGTGCATGTCCTCTAGGCTT
ACCATCTAACAAGTATTATTTTACCATCAAAGGTTTTTAAAGCAAATCAACAAGGAATACCATTTACTTGGACATGTAGAAAACACATAACCTTTTGAGC
TGATTGCGGTAACTTGAAGATCCTTCCATCTTATTTCTTATTAGTTTTT
>LE_HBa0080K11_T7_20853 (trimmed for quality and cloning vector)
AGCTTATGCTTGTAGTAATTTTTCGCCTCTTTTCCAAGACTATATATTCTTATCTTCTTTTTTTCATCCGCAGCTTCGTAATACGATTGATCAGATTGAG
ATACCTTTTTTTCCGTAAGATCTCTTCATACCCTTCCTGTATTAAGTAGAGTTAAAGAGAGGACATTAAAGATTAGGAAAAAAAATATATTGGTCAACTA
TGTAAGTTTCTAAAGAATAGGAAACCACATGATTTACATTTGTAAGAGGGGCATGTCTAACCCTAGACAACCGGATGCAAAAGAACTCACACTGGTGCTA
TGAAGCTTGGAACTTCTTCCGTACAACTTCTAGATTGAAAAGGGTCATGCCTCAGACAGTAAGGCAAGCCCATGAAGTTTATATATTTGGAGAGTTGATA
AAATCATCAGAAAGGTTTAGGAAATGGTCCCAAAAATCATCTTTTGGTATTCATGGACAAAAGCAACACCAGATGATTTGCTAGCACAAAAACTCTAACC
TCTTATCTGAAGTCTAACTATTTAGCTAATTTGTTTAGCTCATATGCTTTACCCTTGTAACTAATGAAGATACTTTTGTGGATTTTATATGCTCATTATC
ACCGCTAAAATTTTTTTTTGTAATAAATAAAGCAAAGGTGCATGTCCTCTAGGCTTACCATCTAACAAGTATTATTTTACCATCAAAGGTTTTTAAAGCA
AATCAACAAGGAATACCATTTACTTGGACATGTAGAAAACACATAA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.952759
Expected error %
0.57157
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0080K11
Clone
Clone name
hba-80k11
LE_HBa0080K11
P080K11
Clone type
BAC
Contamination
none
Estimated length
93,499
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found