Clone Read LE_HBa0080K14_T7_20859

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0080K14_T7_20859
Primer
T7
ID from Seq. Facility
LE_HBa_080_K14-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
613 trimmed for vector and quality, 861 raw
Genbank Accession
Sequence
>LE_HBa0080K14_T7_20859 (raw untrimmed)
ACTGGGACCCGGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGTACTGAATTATGAAGGAAACCCTTTTCTCGACTTTACTCAATTTATGGAT
ACTCAACTCAAGGCTATATTGAACAACATTAAAGATGAAGTTTATATAAAGCATTAAAAACAGTAAAAAAACAAATCAATATACATATATAATATAAATT
AATATAACTTTGTGGGAGTTTCTCTAACCGAAAACCATCACTATAAGCTATGTGATGATACAACTTTTTGCCCATGCTGCCAGAGCTGTTCTCTAAATTG
CGAAGATATAGAATATCTCAACTAAGTGGATCCACTAGTCTATGCTAAAAAATACTAAGGAATCACCTAAGAAGTATGACCATTTCTACCCATTATGACT
ACATGGTTTATGGAGACATTGAGTTCTTATGAAATCGTCCCCACATCAGTGATCAATGCTACTCCCAAGATACTCAACTCATATGTTTTAAATATGATAA
ATCTCTCAGTAGTTTGAGATAATTACTTAAAAACTAGCTCAAAAGCTCTCTTAGAAATCCTCTGAATACATTTCCTCTTTGGGAATACTTAGTTCGGATT
TACTCTTTTTGAAGAAATGAAATTTATTTGTTACTCTTACCTAACTTCAGACTCAAATTTTTTAAACAAGATTAAAACATTTTTAAAAAACTCTATTGAA
AATCTCTAGGATTGGGATCTAATTTCCTTTGAATTTGAATTTTATGAATCCAAGGGTTAGATTCCAGTTTTATGGGATAGTTTCCGAGGGGGTTAGAAGT
TCTTTTTTTAGTATTTAAGAATCAATAAGAAAGGTGTTCTTATTTCCTTTAAATGGGACTT
>LE_HBa0080K14_T7_20859 (trimmed for quality and cloning vector)
AGCTTGTACTGAATTATGAAGGAAACCCTTTTCTCGACTTTACTCAATTTATGGATACTCAACTCAAGGCTATATTGAACAACATTAAAGATGAAGTTTA
TATAAAGCATTAAAAACAGTAAAAAAACAAATCAATATACATATATAATATAAATTAATATAACTTTGTGGGAGTTTCTCTAACCGAAAACCATCACTAT
AAGCTATGTGATGATACAACTTTTTGCCCATGCTGCCAGAGCTGTTCTCTAAATTGCGAAGATATAGAATATCTCAACTAAGTGGATCCACTAGTCTATG
CTAAAAAATACTAAGGAATCACCTAAGAAGTATGACCATTTCTACCCATTATGACTACATGGTTTATGGAGACATTGAGTTCTTATGAAATCGTCCCCAC
ATCAGTGATCAATGCTACTCCCAAGATACTCAACTCATATGTTTTAAATATGATAAATCTCTCAGTAGTTTGAGATAATTACTTAAAAACTAGCTCAAAA
GCTCTCTTAGAAATCCTCTGAATACATTTCCTCTTTGGGAATACTTAGTTCGGATTTACTCTTTTTGAAGAAATGAAATTTATTTGTTACTCTTACCTAA
CTTCAGACTCAAA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.937662
Expected error %
0.635304
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0080K14
Clone
Clone name
hba-80k14
LE_HBa0080K14
P080K14
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found