Clone Read LE_HBa0080P13_T7_21097

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0080P13_T7_21097
Primer
T7
ID from Seq. Facility
LE_HBa_080_P13-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
694 trimmed for vector and quality, 832 raw
Genbank Accession
Sequence
>LE_HBa0080P13_T7_21097 (raw untrimmed)
CCTCGGTACCCGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTAACCATCATTAACCTAAAGACCCCTTTCAGGGTAAACTCTCTTCCTTCGCT
CTTATTTCTCTCCCTTTATGAACTCACCATTGAAGGCTAGCAAGAACTAGGGTTTGGAGGCTGTAAAAAAGGGTGGATTCTTCATCAAATTGTTGAGAAA
CATTCAGGTATGTGTTCTATTCACCTTTGAGATTCTTTCCTCAAAGGGTTACTTCAAAATATATTTCAAAAAGTTGTGTTTTCTTATGGGTTTCATTCAA
TTACTAAAGTTAAGTTATGGATTGAGTTTTTAATGAACTATTAGAATTATATTGAGTAGATTAACATGTAGTTCAACTTGTATATGGTAATTGTTGATGG
TTTGGTTTTAATTGAAGATTATGATCCTCTATCTCTAACCTTAAGTAGTGATCTTGACCTATATTGTATTGTGATCATTCAATTTAGTTGGTTGTTTATT
TTATTACTATCCTATGGTGCTATTATGATTAAATTAAGATGAATTAGGACTATCATGCTATTTCTTGAGATGTGATTTAGGTGATGAATTATAATGTGAA
ATTAGCCTATGTACCTTGTCTCAAGTTGTGATCTAAAGATGACTTGTGTTATGGAGATGCAGTTGTCCTTGTTATTCTATTGGTTATTATCGTGCGATGA
TGTTACTCCCCAAGTTGGTTTGAGTTATGGGTTGATGGTAAAACCTTGATGATAAACTTTAGAAAACTTTGTATGGTCTAAAAATCTCTATTTTATTTTC
AATTGGGAATTGATTATTCCTTAAGTCTGGTT
>LE_HBa0080P13_T7_21097 (trimmed for quality and cloning vector)
AGCTTAACCATCATTAACCTAAAGACCCCTTTCAGGGTAAACTCTCTTCCTTCGCTCTTATTTCTCTCCCTTTATGAACTCACCATTGAAGGCTAGCAAG
AACTAGGGTTTGGAGGCTGTAAAAAAGGGTGGATTCTTCATCAAATTGTTGAGAAACATTCAGGTATGTGTTCTATTCACCTTTGAGATTCTTTCCTCAA
AGGGTTACTTCAAAATATATTTCAAAAAGTTGTGTTTTCTTATGGGTTTCATTCAATTACTAAAGTTAAGTTATGGATTGAGTTTTTAATGAACTATTAG
AATTATATTGAGTAGATTAACATGTAGTTCAACTTGTATATGGTAATTGTTGATGGTTTGGTTTTAATTGAAGATTATGATCCTCTATCTCTAACCTTAA
GTAGTGATCTTGACCTATATTGTATTGTGATCATTCAATTTAGTTGGTTGTTTATTTTATTACTATCCTATGGTGCTATTATGATTAAATTAAGATGAAT
TAGGACTATCATGCTATTTCTTGAGATGTGATTTAGGTGATGAATTATAATGTGAAATTAGCCTATGTACCTTGTCTCAAGTTGTGATCTAAAGATGACT
TGTGTTATGGAGATGCAGTTGTCCTTGTTATTCTATTGGTTATTATCGTGCGATGATGTTACTCCCCAAGTTGGTTTGAGTTATGGGTTGATGG

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.932035
Expected error %
0.741197
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0080P13
Clone
Clone name
hba-80p13
LE_HBa0080P13
P080P13
Clone type
BAC
Contamination
none
Estimated length
95,679
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found