Clone Read LE_HBa0082F22_SP6_21402

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0082F22_SP6_21402
Primer
SP6
ID from Seq. Facility
LE_HBa_082_F22-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
603 trimmed for vector and quality, 750 raw
Genbank Accession
Sequence
>LE_HBa0082F22_SP6_21402 (raw untrimmed)
GGGAAATTAAAGGCGTCTTTTCGTATCCTANGCCCTTAGTATATCGCCAAAGTCTATTCTCCCGTTTGGGAAAAACAACAAGCAAGTCATCGGGAAAGAC
TTTCGGAAAATCCCTACTGACGGGTACAGACTCTAATGGCGGAACCTCTGATTCAAGGTCCTTTACCCTCACAAAATGGTAGAGACAGCCCTTAGAGATC
ATTTTACAAGATTTATGACACGAAATGATTCAAACTCTAAGGATAGAGTTACCCCCCTTCTAGTCTAAGACATGTTAATTAGGGAATTGGAACTTCACCA
CGCCTGTCCTACATTCAATGGACGCAAAACAAACATGTAACCAATCATTCCCAAGCACACATCAAAGTTAACCATATCAAGTTCTACCAAGTCAACCAAA
GAAACTCTATTAGGCAATGATATAAGACAACTCCTAAACACTCTTCTAGCCACAACGGAGTCACACACTAGGGTAGCAACCAAAAAAGGGTTCAATTAAA
ACATTCAACTTTCTAGCTACTAAAGGAGTTACGAATGATAAGGTGGAACTAGAATCTATTAAAGCATACACATTTATGGAAAACACTTGTAACCTACCAG
TGACAACATGGGAGACTGCTCTTGATCACTCCTAGAGTGGAGAGCATAAAAGCAAATCTTCTTTGGAGAGTTCGGGATTGGGAGCACTTGTGTGTTCTTG
AAACTTTTCCCTTTCTTAACATTCATCATAGGACAGTCCCCTCTTCCTGT
>LE_HBa0082F22_SP6_21402 (trimmed for quality and cloning vector)
GCCAAAGTCTATTCTCCCGTTTGGGAAAAACAACAAGCAAGTCATCGGGAAAGACTTTCGGAAAATCCCTACTGACGGGTACAGACTCTAATGGCGGAAC
CTCTGATTCAAGGTCCTTTACCCTCACAAAATGGTAGAGACAGCCCTTAGAGATCATTTTACAAGATTTATGACACGAAATGATTCAAACTCTAAGGATA
GAGTTACCCCCCTTCTAGTCTAAGACATGTTAATTAGGGAATTGGAACTTCACCACGCCTGTCCTACATTCAATGGACGCAAAACAAACATGTAACCAAT
CATTCCCAAGCACACATCAAAGTTAACCATATCAAGTTCTACCAAGTCAACCAAAGAAACTCTATTAGGCAATGATATAAGACAACTCCTAAACACTCTT
CTAGCCACAACGGAGTCACACACTAGGGTAGCAACCAAAAAAGGGTTCAATTAAAACATTCAACTTTCTAGCTACTAAAGGAGTTACGAATGATAAGGTG
GAACTAGAATCTATTAAAGCATACACATTTATGGAAAACACTTGTAACCTACCAGTGACAACATGGGAGACTGCTCTTGATCACTCCTAGAGTGGAGAGC
ATA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.964933
Expected error %
0.625839
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT38724.1| Score 131 E Value 1e-29 Identity 14.30% Align. Length 551bp (91.38%) Frame 3
putative retrotransposon protein [Solanum demissum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT38744.1| Score 129 E Value 5e-29 Identity 14.10% Align. Length 551bp (91.38%) Frame 3
putative gag-pol polyprotein [Solanum demissum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0082F22
Clone
Clone name
hba-82f22
LE_HBa0082F22
C03HBa0082F22
P082F22
Clone type
BAC
Contamination
none
Estimated length
102,712
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found