Notice: SGN will be briefly unavailable for maintenance. Apologies.

Clone Read LE_HBa0082G20_SP6_21446

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0082G20_SP6_21446
Primer
SP6
ID from Seq. Facility
LE_HBa_082_G20-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
579 trimmed for vector and quality, 790 raw
Genbank Accession
Sequence
>LE_HBa0082G20_SP6_21446 (raw untrimmed)
CTTTTTTCGCCTCCCTTACAAGGTCGTACCACGTATGTCATCAATGAATACAATGACAAAGAGATCTAGCATATGGCTTAAAAATCTCATTCATCAAACT
CATGAAAGCAGCAGGGGCATTAGTAAGCCCAAAAGACATTACTAAGAACTCATAATGTCCATACCTGGTCCGAAAAGCAGTCTTTGGCACATCCGTTATC
CGTATTTTTAATTGATTATAACCAGACCTCAAATCGATTTTTGAGATAGTACAAGCACCTTGTAACTGATTAAACAAATCATCGATGCGAGGAAGAGGGT
ACTTGTTCTTAATAGTTACCTTATTCAGTTGTCTGTAGTCAATGCACATCCGAAAACTTTCATCCTTCTTCTTCACAAACAAAACCAGAGCACCCCAAGG
AGATGCACTTGGTCTAATGAAGCCTTTGCTTAACAACTCTTGAAGTTGGGACTTTAAATCTCTTAACTCAGCGGGAGACATCCTATAAGGGGGTATGGAA
ATGGGGAAAGTACCCGGCACCAGATCAATGCAAAAGTCAATATCCCTATCCGGTGGCATACCAGGAAGGTCTGCAGGAAACACATCCAGAAACTCACGGA
CTATCGAAACCGACTCAATTGAAGGCACTTGGGGTTGTATCATTCCCTGATTTGTGCCCAGAAAGCTAAACCACCCCCTTTTCAACCATTTCTCTTAGCC
TGGAGAAAGGAAATAATACCAAATGGGAGTGGAAAGTGTTAGTCCCCCCTCCCACACTAAACGGGATTTTGTCCCAAGGCTTGGGCCAAG
>LE_HBa0082G20_SP6_21446 (trimmed for quality and cloning vector)
ATGTCATCAATGAATACAATGACAAAGAGATCTAGCATATGGCTTAAAAATCTCATTCATCAAACTCATGAAAGCAGCAGGGGCATTAGTAAGCCCAAAA
GACATTACTAAGAACTCATAATGTCCATACCTGGTCCGAAAAGCAGTCTTTGGCACATCCGTTATCCGTATTTTTAATTGATTATAACCAGACCTCAAAT
CGATTTTTGAGATAGTACAAGCACCTTGTAACTGATTAAACAAATCATCGATGCGAGGAAGAGGGTACTTGTTCTTAATAGTTACCTTATTCAGTTGTCT
GTAGTCAATGCACATCCGAAAACTTTCATCCTTCTTCTTCACAAACAAAACCAGAGCACCCCAAGGAGATGCACTTGGTCTAATGAAGCCTTTGCTTAAC
AACTCTTGAAGTTGGGACTTTAAATCTCTTAACTCAGCGGGAGACATCCTATAAGGGGGTATGGAAATGGGGAAAGTACCCGGCACCAGATCAATGCAAA
AGTCAATATCCCTATCCGGTGGCATACCAGGAAGGTCTGCAGGAAACACATCCAGAAACTCACGGACTATCGAAACCGA

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.974645
Expected error %
0.350099
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT66771.1| Score 304 E Value 1e-82 Identity 79.00% Align. Length 576bp (99.48%) Frame 1
putative polyprotein [Solanum demissum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT39297.1| Score 303 E Value 6e-82 Identity 80.10% Align. Length 576bp (99.48%) Frame 1
putative gag-pol protein [Solanum demissum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0082G20
Clone
Clone name
hba-82g20
LE_HBa0082G20
P082G20
Clone type
BAC
Contamination
none
Estimated length
69,950
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found