Clone Read LE_HBa0082G20_T7_21447

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0082G20_T7_21447
Primer
T7
ID from Seq. Facility
LE_HBa_082_G20-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
777 trimmed for vector and quality, 907 raw
Sequence
>LE_HBa0082G20_T7_21447 (raw untrimmed)
CTAAAACTCGGGACCGGGGGGATCTCTAGAGTCGACCTGCAGGCATGCAAGCTTATATTAATTCAAGTTTATATTAATTTGAATTCAAAAAAATAAAACG
AGATATTATTTATTTTTCAATATTTTGCTTAATAAAATTTTTATCGAAGTGTTTTTTTATATAATATGTGATAAGATGCTGAAATGTCATTTCACTTTGT
TTTTAATATAAAATATGAGATTATATTCAAAAAAAAATTATTTCCTATATGAAAATTTAATTAATTTTTTCTTTGTATTTTATTATATCGTAGAAGTTCT
TTCATTTTATAATTTGGTTCATTCCTGACTTCATCTATTAAGAATTAAGTTGCATGATATTATATATTGCATGATTTCTTTATACATTATAAATCTTTTT
ATACATTATAAATCTTTTTTTATTCTTTTACTTCAATGATATTCTTACTAACTATTTCCTTTTTTATTTCTTTTATAGTTCAAATAATGTCATTATTAAA
TTACAGTTGTGAAATAACTTTCTTGCATATAAAAATTTGATTTTTTATCTTGAAAATTGAAATATTCACGTGATAATTTTGAATTTTATTTTTGATTCAA
ATATCTTTTTCGAGAGTTTTTTTATTGATTAAACATTTTTATTTTTGTTGGTATATAGTATGATTTTTATGTATTTCAAAAAATTTTCTCTCATCTCAAA
TTAAGTGTTTATATTTTAGATTGAAATTATGTAGTTATATGTTTTTCATTTTCTTGGCATGTGTTTCATTTTAAAAAATAAAAAAAAAAAAAAATCAATG
TCCTTCTCTATTATCATCTTCTAATATTAGTAAATAAATATTAACTTTTTCCTTTCAAACTAGCACAAAATTCTATTAAACTCTAATAAATAAACCCAGC
TATTCGT
>LE_HBa0082G20_T7_21447 (trimmed for quality and cloning vector)
AGCTTATATTAATTCAAGTTTATATTAATTTGAATTCAAAAAAATAAAACGAGATATTATTTATTTTTCAATATTTTGCTTAATAAAATTTTTATCGAAG
TGTTTTTTTATATAATATGTGATAAGATGCTGAAATGTCATTTCACTTTGTTTTTAATATAAAATATGAGATTATATTCAAAAAAAAATTATTTCCTATA
TGAAAATTTAATTAATTTTTTCTTTGTATTTTATTATATCGTAGAAGTTCTTTCATTTTATAATTTGGTTCATTCCTGACTTCATCTATTAAGAATTAAG
TTGCATGATATTATATATTGCATGATTTCTTTATACATTATAAATCTTTTTATACATTATAAATCTTTTTTTATTCTTTTACTTCAATGATATTCTTACT
AACTATTTCCTTTTTTATTTCTTTTATAGTTCAAATAATGTCATTATTAAATTACAGTTGTGAAATAACTTTCTTGCATATAAAAATTTGATTTTTTATC
TTGAAAATTGAAATATTCACGTGATAATTTTGAATTTTATTTTTGATTCAAATATCTTTTTCGAGAGTTTTTTTATTGATTAAACATTTTTATTTTTGTT
GGTATATAGTATGATTTTTATGTATTTCAAAAAATTTTCTCTCATCTCAAATTAAGTGTTTATATTTTAGATTGAAATTATGTAGTTATATGTTTTTCAT
TTTCTTGGCATGTGTTTCATTTTAAAAAATAAAAAAAAAAAAAAATCAATGTCCTTCTCTATTATCATCTTCTAATA

This is probably not a useful sequence.

Problems:
  • Low complexity
Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.817275
Expected error %
0.666691
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0082G20
Clone
Clone name
hba-82g20
LE_HBa0082G20
P082G20
Clone type
BAC
Contamination
none
Estimated length
69,950
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found