Clone Read LE_HBa0082L13_SP6_21672

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0082L13_SP6_21672
Primer
SP6
ID from Seq. Facility
LE_HBa_082_L13-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
554 trimmed for vector and quality, 791 raw
Genbank Accession
Sequence
>LE_HBa0082L13_SP6_21672 (raw untrimmed)
AACTTTCCTCCCCTCTAGGTTATCCACCAAGGCCAAATNTCGCCTTTTTTTTGTCTCATCAAACTCCTTAGATCCTTTTATTTCACCAACCATGTGATGG
GAGCATCCACTATCCACAAACCAAACATCAGTTTTGTAATCTATTGTGGTAGAGTGAGCCATGAAAAGCACGTTTTCTTCTTCTTCCTCCTCTTCCTCAG
CATAACTAGATTGATCATTTTATACCAAAAGTTAGCTTCTATATGGCCAAACCTATTACACTTCTAACACTGCACTCAACTTCAGCGCCTATTTGTCCAC
CCAGATTGGCTTGTGCCTCTACCACGTCCTCTACCTCTAAAAGAGCCTCTGCCACGTCCTCGAGTTCCTTGTTCTAACGACTTCTGATTTTTAATTGGAT
TCTCTTCTTTCACTTGAAAATGCTTGTTCTTGAGTTGTCGCTATTGACTTATTGATCCGTGACTCATGAGATTGCAAAGATCCCATTATTTCATTAAATG
AAAACATAGATAAATCTCTTAATTCCCTCTATCGCTGCAACCACCTGATCAAACTTTATAGGTAAACTTCTTTAAACTTTTGGAACTAAAATTTTATCAC
CTATATCTTGACCAGTATGATTTTAATTGACTTTCCATTTCCACTAACTCTTGATAAAAAAGCTTGCACAGAATTCATTGGTATTCCTGAACATGGTTTA
CAAATCACGACGAATAAATTGTCCTTTCACCGTAATTACCTTTGAGGAAACTTGGAAACTCCCTTTTCTAAAACTTACCTAATTTATTTTG
>LE_HBa0082L13_SP6_21672 (trimmed for quality and cloning vector)
GCCTTTTTTTTGTCTCATCAAACTCCTTAGATCCTTTTATTTCACCAACCATGTGATGGGAGCATCCACTATCCACAAACCAAACATCAGTTTTGTAATC
TATTGTGGTAGAGTGAGCCATGAAAAGCACGTTTTCTTCTTCTTCCTCCTCTTCCTCAGCATAACTAGATTGATCATTTTATACCAAAAGTTAGCTTCTA
TATGGCCAAACCTATTACACTTCTAACACTGCACTCAACTTCAGCGCCTATTTGTCCACCCAGATTGGCTTGTGCCTCTACCACGTCCTCTACCTCTAAA
AGAGCCTCTGCCACGTCCTCGAGTTCCTTGTTCTAACGACTTCTGATTTTTAATTGGATTCTCTTCTTTCACTTGAAAATGCTTGTTCTTGAGTTGTCGC
TATTGACTTATTGATCCGTGACTCATGAGATTGCAAAGATCCCATTATTTCATTAAATGAAAACATAGATAAATCTCTTAATTCCCTCTATCGCTGCAAC
CACCTGATCAAACTTTATAGGTAAACTTCTTTAAACTTTTGGAACTAAAATTTT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.947988
Expected error %
0.38986
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0082L13
Clone
Clone name
hba-82l13
LE_HBa0082L13
P082L13
Clone type
BAC
Contamination
none
Estimated length
101,150
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found