Clone Read LE_HBa0082L13_T7_21673

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0082L13_T7_21673
Primer
T7
ID from Seq. Facility
LE_HBa_082_L13-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
655 trimmed for vector and quality, 925 raw
Genbank Accession
Sequence
>LE_HBa0082L13_T7_21673 (raw untrimmed)
CTTAACTCGGTCCCGGGGGAATCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGCTATCAAACCTTGCAATACTACAATGGTCCCCAATGTGAATCTTAT
GAAAGATGATGGTGATCCTTTCGATGATCTTGAGAGATACAGGAGGTTAGTTAGGAAGTTAAACTACCTCACTGTGACTCATCCGGATATTGCCTTTGCA
GTAAGTATTGTTAGCCAACTTATGTCAATGCCAACGGTCAAACATTGGGAAGCTTTAGAACAAATTCTTTGTTACTTGCAATGAGCTCCTTGACGTGGCA
TATTGGATGGAAATCATGGTCATACTAGTGTAGAGTGCTTTGCTGATGCTGATTGAGCGGGATCTAAAATTGATATAAGATCCACAACAGGCTATGGTGT
TTTTGTTGGAGGGGAAATAGTATCATGGAGAAGTAAGAAACAAAGTGTTGTATCTCGATCTAGTGGTGAATTTAATTATAGAGCTATGTCATAGTCTACG
TGTGAGATTATATGGATATATCATCTATTATCTGAAATTGGAGTGAAGCATTATACACTAGCAAAACTCTGGTGTGACAATCAGGTTGTTATTCATATAG
CCCTCAATTCGGTGTATTATGAAAGGACTAAACACCTTAAGGTTGACCGTCATTTTATTCGTCAGAAGATTCAGGATAATTTGATTTCCACAGGCTACGT
GAAAACGGGGGAGAAATTAGGTGATTTGTTCATCAGGGATTGAATGGAATCCGGGTTATTATTTTTTGTGACCAGACGGGCGGCGATCCATTTCTATGCT
TTCCTTTGGGGGGTGTTTTCGAATTATGGTTGCCAATCCATAGTGATTCCTTGATATTACAGAATCACAAAGTTTTTGAGACTTTTTTCTTTATTTGTTC
TGCTGGTTCCTTTTCACATCTTCCN
>LE_HBa0082L13_T7_21673 (trimmed for quality and cloning vector)
AGCTTGCTATCAAACCTTGCAATACTACAATGGTCCCCAATGTGAATCTTATGAAAGATGATGGTGATCCTTTCGATGATCTTGAGAGATACAGGAGGTT
AGTTAGGAAGTTAAACTACCTCACTGTGACTCATCCGGATATTGCCTTTGCAGTAAGTATTGTTAGCCAACTTATGTCAATGCCAACGGTCAAACATTGG
GAAGCTTTAGAACAAATTCTTTGTTACTTGCAATGAGCTCCTTGACGTGGCATATTGGATGGAAATCATGGTCATACTAGTGTAGAGTGCTTTGCTGATG
CTGATTGAGCGGGATCTAAAATTGATATAAGATCCACAACAGGCTATGGTGTTTTTGTTGGAGGGGAAATAGTATCATGGAGAAGTAAGAAACAAAGTGT
TGTATCTCGATCTAGTGGTGAATTTAATTATAGAGCTATGTCATAGTCTACGTGTGAGATTATATGGATATATCATCTATTATCTGAAATTGGAGTGAAG
CATTATACACTAGCAAAACTCTGGTGTGACAATCAGGTTGTTATTCATATAGCCCTCAATTCGGTGTATTATGAAAGGACTAAACACCTTAAGGTTGACC
GTCATTTTATTCGTCAGAAGATTCAGGATAATTTGATTTCCACAGGCTACGTGAA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.95927
Expected error %
0.888975
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At4g23160.1 Score 128 E Value 3e-30 Identity 11.20% Align. Length 617bp (94.20%) Frame 1
68417.m03342 protein kinase family protein contains Pfam domain PF00069: Protein kinase domain
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAO26684.1| Score 281 E Value 1e-74 Identity 21.30% Align. Length 641bp (97.86%) Frame 1
gag-pol polyprotein [Vitis vinifera]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAO26683.1| Score 281 E Value 1e-74 Identity 21.30% Align. Length 641bp (97.86%) Frame 1
gag-pol polyprotein [Vitis vinifera]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0082L13
Clone
Clone name
hba-82l13
LE_HBa0082L13
P082L13
Clone type
BAC
Contamination
none
Estimated length
101,150
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found