Clone Read LE_HBa0005P17_T7_2289

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0005P17_T7_2289
Primer
T7
ID from Seq. Facility
LE_HBa_005_P17-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
647 trimmed for vector and quality, 908 raw
Genbank Accession
Sequence
>LE_HBa0005P17_T7_2289 (raw untrimmed)
GCGGGGACCGGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTTATGCCAAATTCTCAAAGTGTGACCTTTTGTTAGATTCAGTGTCCTTCTTAG
GGCACGTATTTTCTCCCGATGGAGTGATGGTGGATCCATCTAAAATTGAAGCAGTGAAGAGTTGGGACAGACCTACTAATGTTACAGAAGTAAGGAGCTT
TGTTGGTTTAGCTAGCTACTACCGCTGATTTTTCAAGGGATTTTCCTCTGTTGCTTCCCAATTCACAAATTTCACTAAGCAGAGTGTCCCATTTGTATGG
TCGGACGAGTGCAAAGAAAGCTTTCAGAAGCTCAAGACCTGGTTGACTACTGCGCCAATCCTTACCCTGCCAGTGGAAGGTATGAATTTCATTGTCTATT
GTGATGCATCCTATTCGGGTCTGGGTGCAGTGCTAATGCAAGAGAAGAATGTAATTGCTTATGCTTCGAGGCAATTAAAGGTGCATGAACGTAATTATCC
AACCCATGATTTGGAGTTGGCTGCGATGGTGTTTGCATTAATGAAATGGAGGCACTATCTATACGGGGTTAAGTGTGGGGTCTATACGGATCATCGTACC
CTACAGTATGTCTTTACTCATAAAGATTTGAACTTCAGACAGAGGAGATTGATGGAACTACTGAAGGACTACGATATCACTATCTTGTATCATCCGGTGA
AAAGCAATGTTGTGGCAGATGCTTTAAGTAGAAGGGCAGGAAGCATGGGAAGTATAGCTCACTTGCCATTTTCTACACCCCCATTGGCCAGAAAAATTCA
GAGTCCTGATAATGGACTTCATGAACCTTAGAATATAATAAAAAAAAGGGGAATTTTTTGGCCAATGGGAGAAGGCATCTAATTTTTTTTTTTTTATGAA
AACCTTTT
>LE_HBa0005P17_T7_2289 (trimmed for quality and cloning vector)
AGCTTTATGCCAAATTCTCAAAGTGTGACCTTTTGTTAGATTCAGTGTCCTTCTTAGGGCACGTATTTTCTCCCGATGGAGTGATGGTGGATCCATCTAA
AATTGAAGCAGTGAAGAGTTGGGACAGACCTACTAATGTTACAGAAGTAAGGAGCTTTGTTGGTTTAGCTAGCTACTACCGCTGATTTTTCAAGGGATTT
TCCTCTGTTGCTTCCCAATTCACAAATTTCACTAAGCAGAGTGTCCCATTTGTATGGTCGGACGAGTGCAAAGAAAGCTTTCAGAAGCTCAAGACCTGGT
TGACTACTGCGCCAATCCTTACCCTGCCAGTGGAAGGTATGAATTTCATTGTCTATTGTGATGCATCCTATTCGGGTCTGGGTGCAGTGCTAATGCAAGA
GAAGAATGTAATTGCTTATGCTTCGAGGCAATTAAAGGTGCATGAACGTAATTATCCAACCCATGATTTGGAGTTGGCTGCGATGGTGTTTGCATTAATG
AAATGGAGGCACTATCTATACGGGGTTAAGTGTGGGGTCTATACGGATCATCGTACCCTACAGTATGTCTTTACTCATAAAGATTTGAACTTCAGACAGA
GGAGATTGATGGAACTACTGAAGGACTACGATATCACTATCTTGTAT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.978439
Expected error %
0.622876
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT38745.1| Score 320 E Value 2e-86 Identity 23.40% Align. Length 644bp (99.54%) Frame 1
putative polyprotein, 3'-partial [Solanum demissum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT66771.1| Score 317 E Value 2e-85 Identity 23.10% Align. Length 644bp (99.54%) Frame 1
putative polyprotein [Solanum demissum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0005P17
Clone
Clone name
hba-5p17
LE_HBa0005P17
C02HBa0005P17
P005P17
Clone type
BAC
Contamination
none
Estimated length
246,830
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found