Clone Read LE_HBa0085I08_SP6_23054

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0085I08_SP6_23054
Primer
SP6
ID from Seq. Facility
LE_HBa_085_I08-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
580 trimmed for vector and quality, 961 raw
Sequence
>LE_HBa0085I08_SP6_23054 (raw untrimmed)
AAAAAAAAAAAGATTTTCTTTCAGCTATGGNACGGNCGCGCCTCTTAGAGCGCCAGGGTCACGTGGAGATCCCATTTTCCCCCATATTTTACTATTAGTT
CCTAAGTGATGTAGATAGAATTAATAGTTGAATCCAAAAATATAAAGTATATATAAAGATAAAGAAATGATAAATAAAGATGAGATAAGATTGATTGAAT
AAATAATAAAATTAAAGGAAAGTTAAGATNAAAGTAAAAGAAGTTAAGAGTTAAGTGTAAAAGTTAAAAAGAAAGTAAAAGTGAGTTTTAAAAGTTTTAA
AGAGTATTAAAAAAAAAAATTTAATTTGTTTTGAGGATAATGTTATAGGTTGAGTAAAGAGTAATTATTTGGGTTTAAATATAAAAAGTTGTAAGGGAGT
TAAGTATTGGGTAAGAGTTAAGTATTAAGTAAAGTAAAGATGAAAGAGTGAGTTGATTTATAAATATATATAAGGGAAGTAAGTAGTANATTAGAGTATA
AATGTTTTTATATTTGGAGAAAGAAATGAATNTAGAGTTNNATAAAGGGTTTGGTTAGTTTTAGAAAATGGGAAGTATGATTTGGAAGGGAGGTTTTAAA
GGTATGTTTGAGTAATTANNTNAAAGAAGAGAAGAAGTTGTTTTAAAAANATATGAGNTATGTATTTTGGGAGTAGTATTGAGNANTGATATAGGGAGAN
GAGTTTATATGAATTAAATTATTNATAAAGNATGTAGNGAGTTTTAAGGGATAAAGAATAATAAATTTTAAATGATTTATTAGTGGTTTTTAGAATAAAA
TAGTGGATTAGTTAGTAGTTAAATAGTTTTTTAGAAAGAAAGAATAGGGAGGGTTTGGTGAAATGTGAAGGAAAGGTTGTGATATGGATAAGGTTAAAGT
GAAAGTTTGGGGGGTAGAAAGTTTTAAAAAAAAAAATTTAATTTTAAATTTAATGAAATTG
>LE_HBa0085I08_SP6_23054 (trimmed for quality and cloning vector)
GCGCCTCTTAGAGCGCCAGGGTCACGTGGAGATCCCATTTTCCCCCATATTTTACTATTAGTTCCTAAGTGATGTAGATAGAATTAATAGTTGAATCCAA
AAATATAAAGTATATATAAAGATAAAGAAATGATAAATAAAGATGAGATAAGATTGATTGAATAAATAATAAAATTAAAGGAAAGTTAAGATNAAAGTAA
AAGAAGTTAAGAGTTAAGTGTAAAAGTTAAAAAGAAAGTAAAAGTGAGTTTTAAAAGTTTTAAAGAGTATTAAAAAAAAAAATTTAATTTGTTTTGAGGA
TAATGTTATAGGTTGAGTAAAGAGTAATTATTTGGGTTTAAATATAAAAAGTTGTAAGGGAGTTAAGTATTGGGTAAGAGTTAAGTATTAAGTAAAGTAA
AGATGAAAGAGTGAGTTGATTTATAAATATATATAAGGGAAGTAAGTAGTANATTAGAGTATAAATGTTTTTATATTTGGAGAAAGAAATGAATNTAGAG
TTNNATAAAGGGTTTGGTTAGTTTTAGAAAATGGGAAGTATGATTTGGAAGGGAGGTTTTAAAGGTATGTTTGAGTAATT

This is probably not a useful sequence.

Problems:
  • High predicted error rate
Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.86022
Expected error %
5.09079
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0085I08
Clone
Clone name
hba-85i8
LE_HBa0085I08
C07HBa0085I08
P085I08
Clone type
BAC
Contamination
none
Estimated length
132,622
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found