Clone Read LE_HBa0006A17_SP6_2336

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0006A17_SP6_2336
Primer
SP6
ID from Seq. Facility
LE_HBa_006_A17-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
816 trimmed for vector and quality, 981 raw
Genbank Accession
Sequence
>LE_HBa0006A17_SP6_2336 (raw untrimmed)
CCTGTTCAAGCTATGTCACTAATTACTGTTCCGAGTTTCATCTTGAAGCACAAGATTTCCAGAATCTTGAAGCCTAGCTATTAAACTTCCTGTCAATAAA
GGAGGGGTAATATTCACAACTGTTTTCCCTTCACTAGTGATTTTCAATGTTCCTGTAGTATCTATAGTGAGCAATCCTGAATTGTTCAATAAAGGCGTAT
TTGGATTGGCTATCCATAATTTCTTACCTTGTGGATCACCTGCATACCATATACCGAGATAATAGTTATTTGTTTGTGAGATAGAGAAAAATCCTAACTT
GAATTTTCCACCTTCAGAATCAAGAACCTGAGAGTGATTTAGTTCATCACCAGGCTTCATTGAGGTTATTGCAGCCACAGATGGAAGGTTAATGAGATAT
GTATGGCTGAAGAATAAGGTCAATATTAAGATGAAGATGGGATTGGCTGAAGATTTCATTTTTGGCAGCTAGAAACAAAAACACAAAAAAGTTGCTGCAG
ATAATATGATCATCTCTTTATATAGTTGTCTGTTGTTCAAAGCAAGAAGTCATGAACCTGAGAATAATCAATACTTTGAAACATTTTTCAGCCAGAATTT
TTCAATCATTTACTTGGAGGAAAGCTTGTTGAAAGAGACATTAATCTTGACTTTTTCTAAAAACCAAATTCATATTTGGTGTCTGTTTTTTTTATTTGAC
TTTTCTATTTCTTTCTTTCCTTCCTGGTGTTTTAAACAAAACCAGCACCAAGTGTTCGATTTTTATTGAAAACTAAAAAGTGAACAAACAATTCGCGTAG
GGGGACTAGATCAAAGCCTCCTAAGCTATAGTAACATGATCATAATTTTCAAACCTTAAGATTGCTTAGTAATAATATAATAATATTTTAGAAAAAAAAT
GCAGAAAATTTACTCAAATCTTAATCTGATGAAAGGTGCACTTTTAAAAAAAACATACACAAGATAACAAATTTTCTCAAA
>LE_HBa0006A17_SP6_2336 (trimmed for quality and cloning vector)
CTGTTCCGAGTTTCATCTTGAAGCACAAGATTTCCAGAATCTTGAAGCCTAGCTATTAAACTTCCTGTCAATAAAGGAGGGGTAATATTCACAACTGTTT
TCCCTTCACTAGTGATTTTCAATGTTCCTGTAGTATCTATAGTGAGCAATCCTGAATTGTTCAATAAAGGCGTATTTGGATTGGCTATCCATAATTTCTT
ACCTTGTGGATCACCTGCATACCATATACCGAGATAATAGTTATTTGTTTGTGAGATAGAGAAAAATCCTAACTTGAATTTTCCACCTTCAGAATCAAGA
ACCTGAGAGTGATTTAGTTCATCACCAGGCTTCATTGAGGTTATTGCAGCCACAGATGGAAGGTTAATGAGATATGTATGGCTGAAGAATAAGGTCAATA
TTAAGATGAAGATGGGATTGGCTGAAGATTTCATTTTTGGCAGCTAGAAACAAAAACACAAAAAAGTTGCTGCAGATAATATGATCATCTCTTTATATAG
TTGTCTGTTGTTCAAAGCAAGAAGTCATGAACCTGAGAATAATCAATACTTTGAAACATTTTTCAGCCAGAATTTTTCAATCATTTACTTGGAGGAAAGC
TTGTTGAAAGAGACATTAATCTTGACTTTTTCTAAAAACCAAATTCATATTTGGTGTCTGTTTTTTTTATTTGACTTTTCTATTTCTTTCTTTCCTTCCT
GGTGTTTTAAACAAAACCAGCACCAAGTGTTCGATTTTTATTGAAAACTAAAAAGTGAACAAACAATTCGCGTAGGGGGACTAGATCAAAGCCTCCTAAG
CTATAGTAACATGATC

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.947009
Expected error %
0.202311
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At3g16030.1 Score 84 E Value 9e-17 Identity 12.00% Align. Length 407bp (49.88%) Frame 1
68416.m02027 lectin protein kinase family protein contains Pfam domains PF00069: Protein kinase domain and PF01453: Lectin (probable mannose binding)
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At1g67520.1 Score 80 E Value 1e-15 Identity 12.50% Align. Length 407bp (49.88%) Frame 1
68414.m07692 lectin protein kinase family protein contains Pfam domains PF00069: Protein kinase domain and PF01453: Lectin (probable mannose binding)
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAP45167.1| Score 260 E Value 4e-68 Identity 30.60% Align. Length 431bp (52.82%) Frame 1
putative receptor protein kinase [Solanum bulbocastanum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAP45176.1| Score 194 E Value 2e-48 Identity 28.20% Align. Length 332bp (40.69%) Frame 1
putative receptor protein kinase [Solanum bulbocastanum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0006A17
Clone
Clone name
hba-6a17
LE_HBa0006A17
C08HBa0006A17
P006A17
Clone type
BAC
Contamination
none
Estimated length
109,588
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found