Clone Read LE_HBa0006A17_T7_2337

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0006A17_T7_2337
Primer
T7
ID from Seq. Facility
LE_HBa_006_A17-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
863 trimmed for vector and quality, 959 raw
Genbank Accession
Sequence
>LE_HBa0006A17_T7_2337 (raw untrimmed)
CGCTAGCTTGGAACCGGGGGGACCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGTAGACAGCATCTTTAATAACCCTTTCACACCCACTACAACACATC
CTTACTTTGAGTTCCACCCTCTGTACATAACAAAATTAACAAAAATCAAAATTACATAAGTAAAACATCTATATATTATGATTTATAAGAAATTAAAGCT
AAATTTTTTTCTTTAAAAAAATTGATTTAAAACCTGTAAAGAAAGTGGTCTAGCCTTAGTCATTTTGTGTTTGTTGGTGCCTTGTTGATGATGAGGATGA
TGATATTGAAAAACACAAAAACTAGTTATGGCTGAGAAAAAAGAGCCAAATAATTTCTCTAGTAAGTTAACCATTTGTGAATATGTATATGTATGTATAT
AGATTGAATATATATATAATATCTAGGTAGCAAAATTATACAAACTTATAAGGAGAAGGGAGAGGAAGAAAATATAGTTAATAGGAAGCTTGGTATATCA
CCATTTATAATATAAAAATATTCCTCCAACACAGCAAGGCATATTTTTTTTTCTCTTAAGTTCCAATCTCATGGCAAATAGATTCTAGTAAACCAACAAA
TTAAACTCCTAGTTTGTAATACAATAATCTTTTCAAATATAATTAATTAATTAATTGCCTCCACTTTCTAATTCATGCATAGATTATAAATACATTATCT
GTTTTTTTTCCTTTTAAAAAAAGTAAAAATAAAATAGTAAAAGTATAAATTCCATTAGGAAGGAATAATACTATCGATTAGACTACACTCAGATTTCTTT
ATAACAGTATATTATTATAATATTTATGTTTTTCTGGAAACGATCTTTCGTGTTATAGTTATATTAGATTATAATAATATTTTGCCACAGTAATTAAAAA
TTATTAAACCAATGATGGTATTGTAGAGAAGTCAGACTAATTATTTTGATGAAATTGAT
>LE_HBa0006A17_T7_2337 (trimmed for quality and cloning vector)
AGCTTGTAGACAGCATCTTTAATAACCCTTTCACACCCACTACAACACATCCTTACTTTGAGTTCCACCCTCTGTACATAACAAAATTAACAAAAATCAA
AATTACATAAGTAAAACATCTATATATTATGATTTATAAGAAATTAAAGCTAAATTTTTTTCTTTAAAAAAATTGATTTAAAACCTGTAAAGAAAGTGGT
CTAGCCTTAGTCATTTTGTGTTTGTTGGTGCCTTGTTGATGATGAGGATGATGATATTGAAAAACACAAAAACTAGTTATGGCTGAGAAAAAAGAGCCAA
ATAATTTCTCTAGTAAGTTAACCATTTGTGAATATGTATATGTATGTATATAGATTGAATATATATATAATATCTAGGTAGCAAAATTATACAAACTTAT
AAGGAGAAGGGAGAGGAAGAAAATATAGTTAATAGGAAGCTTGGTATATCACCATTTATAATATAAAAATATTCCTCCAACACAGCAAGGCATATTTTTT
TTTCTCTTAAGTTCCAATCTCATGGCAAATAGATTCTAGTAAACCAACAAATTAAACTCCTAGTTTGTAATACAATAATCTTTTCAAATATAATTAATTA
ATTAATTGCCTCCACTTTCTAATTCATGCATAGATTATAAATACATTATCTGTTTTTTTTCCTTTTAAAAAAAGTAAAAATAAAATAGTAAAAGTATAAA
TTCCATTAGGAAGGAATAATACTATCGATTAGACTACACTCAGATTTCTTTATAACAGTATATTATTATAATATTTATGTTTTTCTGGAAACGATCTTTC
GTGTTATAGTTATATTAGATTATAATAATATTTTGCCACAGTAATTAAAAATTATTAAACCAA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.895512
Expected error %
0.626144
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0006A17
Clone
Clone name
hba-6a17
LE_HBa0006A17
C08HBa0006A17
P006A17
Clone type
BAC
Contamination
none
Estimated length
109,588
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found