Clone Read LE_HBa0086L23_T7_23997

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0086L23_T7_23997
Primer
T7
ID from Seq. Facility
LE_HBa_086_L23-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
744 trimmed for vector and quality, 791 raw
Genbank Accession
Sequence
>LE_HBa0086L23_T7_23997 (raw untrimmed)
ATGCCTGGGTACCGGGGGGATCTCTAGAGTCGACCTGCAGGCATGCAAGCTTCTGCTTGTTCTTGTTGGTCCTATTACCTTTCCTTCTCGGCTGCACGGA
AGAGTCGACCGCAACCTTGGCATTATTGACCATGTTTAATTCAGCATTTAAACCAACTTCATGAGCCTCCGTAGATTGAACTTTATTAATAATAACATCA
GTAGGGCCCTTAGATACCTCAGTAATGCAAACAGGGACTGATTTTTCATTGATATTCTTAGGTGTCATATTTGGCCTTTGCTTGAAGCTAGTACGCTTAT
GCCTGATGAGACCCCCATCACTCGACTGACAAGTCTCTTTTCCATGAGAGGCAGAAACCCTATTAGCATCTTGCTTGGATAAAAAAGCCTGGGGTTGTGG
GATGGCTATTTCTGACTGGACCATAATAGAAGTGCCGAATTCTAACACAACAGGTGGATTAATATACTGACTGTCCTTGTTGAGCATGCGCCCACTAGCA
TCAATTACGTCACCGTGAGCTGCTAAAGTTGCATTGCGTGCTTGAGGTTTGACAGTGGACACCACTGTTTCAGGAGCTGAGGAGCCTTGTAGATCTTGCT
TGATAACATCGGCGGGCGAATCCTTTTCAGTCTTCTGACACGAAGCATCACCTGCCTGCATACGACGATTCAATTCCTCTAATTTAGCAAGAGCTTTAGC
TTTCTGTTGTTTAATTCGTTCTTCCTCTTCTTTCTGCAACTGTAAGGCACGCTGCCTGGCCAACTCTTTCATCTTTGTGCGCTAATTGAAA
>LE_HBa0086L23_T7_23997 (trimmed for quality and cloning vector)
AGCTTCTGCTTGTTCTTGTTGGTCCTATTACCTTTCCTTCTCGGCTGCACGGAAGAGTCGACCGCAACCTTGGCATTATTGACCATGTTTAATTCAGCAT
TTAAACCAACTTCATGAGCCTCCGTAGATTGAACTTTATTAATAATAACATCAGTAGGGCCCTTAGATACCTCAGTAATGCAAACAGGGACTGATTTTTC
ATTGATATTCTTAGGTGTCATATTTGGCCTTTGCTTGAAGCTAGTACGCTTATGCCTGATGAGACCCCCATCACTCGACTGACAAGTCTCTTTTCCATGA
GAGGCAGAAACCCTATTAGCATCTTGCTTGGATAAAAAAGCCTGGGGTTGTGGGATGGCTATTTCTGACTGGACCATAATAGAAGTGCCGAATTCTAACA
CAACAGGTGGATTAATATACTGACTGTCCTTGTTGAGCATGCGCCCACTAGCATCAATTACGTCACCGTGAGCTGCTAAAGTTGCATTGCGTGCTTGAGG
TTTGACAGTGGACACCACTGTTTCAGGAGCTGAGGAGCCTTGTAGATCTTGCTTGATAACATCGGCGGGCGAATCCTTTTCAGTCTTCTGACACGAAGCA
TCACCTGCCTGCATACGACGATTCAATTCCTCTAATTTAGCAAGAGCTTTAGCTTTCTGTTGTTTAATTCGTTCTTCCTCTTCTTTCTGCAACTGTAAGG
CACGCTGCCTGGCCAACTCTTTCATCTTTGTGCGCTAATTGAAA

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.97969
Expected error %
0.0844745
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0086L23
Clone
Clone name
hba-86l23
LE_HBa0086L23
C03HBa0086L23
P086L23
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found